Adora1 (NM_001291930) Mouse Untagged Clone

CAT#: MC226133

Adora1 (untagged) - Mouse adenosine A1 receptor (Adora1), transcript variant 5


  "NM_001291930" in other vectors (1)

Reconstitution Protocol

USD 210.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Adora1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Adora1
Synonyms A1-AR; A1AR; A1R; AA1R; AI848715; ARA1; BB176431; Ri
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226133 representing NM_001291930
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTTTGGCTGGAACAACCTGAGTGAGGTGGAACAAGCCTGGATAGCCAACGGCAGTGTTGGGGAGCCCG
TGATCAAGTGTGAGTTCGAGAAGGTTATCAGCATGGAGTACATGGTCTACTTCAACTTCTTCGTCTGGGT
GCTGCCGCCATTGCTCCTCATGGTTCTTATCTACCTGGAGGTCTTCTACCTGATCCGCAAGCAGCTCAAC
AAAAAGGTGTCAGCCTCCTCTGGTGACCCCCAGAAGTACTACGGGAAGGAGCTCAAGATCGCCAAGTCGC
TGGCCCTCATCCTCTTCCTCTTTGCCCTCAGCTGGCTACCGCTACACATCTTGAACTGCATCACCCTCTT
CTGCCCCACCTGCCAGAAACCCAGCATCCTCATCTACATTGCCATCTTCCTCACACACGGCAACTCGGCC
ATGAACCCCATCGTCTATGCCTTCCGAATCCACAAGTTCCGGGTCACCTTTCTGAAGATTTGGAACGACC
ACTTCCGATGCCAGCCCAAGCCCCCCATTGAGGAAGATATCCCAGAGGAGAAAGCTGATGACTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001291930
ORF Size 555 bp
Insert Size 555
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001291930.1, NP_001278859.1
RefSeq Size 4624
RefSeq ORF 555
Locus ID 11539
Gene Summary Receptor for adenosine. The activity of this receptor is mediated by G proteins which inhibit adenylyl cyclase. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (5) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 2. The encoded protein (isoform c) is shorter, compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.