Wnt11 (NM_001285795) Mouse Untagged Clone

CAT#: MC226147

Wnt11 (untagged) - Mouse wingless-type MMTV integration site family, member 11 (Wnt11), transcript variant 4


  "NM_001285795" in other vectors (1)

Reconstitution Protocol

USD 210.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Wnt11"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Wnt11
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226147 representing NM_001285795
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCCTGTCGGCCGCCACCATCAGTCACACCATCGCCCGGGCCTGCACCTCTGGCGACCTGCCCGGCTG
CTCCTGCGGCCCCGTCCCAGGCTCTACGTGCCTCCCTGGAAACGAAGTGTAAATGCCATGGGGTGTCTGG
CTCCTGCTCCATCCGCACCTGTTGGAAGGGGCTGCAAGAGCTCCAGGACGTGGCTGCTGACCTCAAGACC
CGCTACCTGTCAGCCACGAAGGTGGTACACCGGCCTATGGGCACCCGCAAACACTTGGTGCCCAAGGACC
TGGATATCCGGCCTGTGAAGGACTCAGAACTTGTGTATCTACAGAGCTCCCCTGACTTCTGCATGAAGAA
TGAGAAGGTGGGATCCCATGGGACCCAAGACAGGCAGTGCAACAAGACTTCCAACGGCAGTGACAGCTGC
GACCTCATGTGCTGTGGGCGCGGCTACAACCCCTACACGGACAGAGTGGTGGAGCGATGTCACTGCAAGT
ACCACTGGTGCTGCTACGTCACCTGCCGCAGGTGTGAGCGCACGGTGGAGCGCTACGTCTGCAAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001285795
ORF Size 558 bp
Insert Size 558
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001285795.1, NP_001272724.1
RefSeq Size 2624
RefSeq ORF 558
Locus ID 22411
Gene Summary Ligand for members of the frizzled family of seven transmembrane receptors. Probable developmental protein. May be a signaling molecule which affects the development of discrete regions of tissues. Is likely to signal over only few cell diameters. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) differs in the 5' UTR and uses an alternate splice junction compared to variant 1. The resulting isoform (c) has a shorter and distinct N-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.