Acy3 (NM_001302482) Mouse Untagged Clone

CAT#: MC226171

Acy3 (untagged) - Mouse aspartoacylase (aminoacylase) 3 (Acy3), transcript variant 4


  "NM_001302482" in other vectors (1)

Reconstitution Protocol

USD 210.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Acy3"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Acy3
Synonyms 0610006H10Rik; AA3; AAIII; Acy-3; AW107362; HCBP1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226171 representing NM_001302482
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCCTCCCTACCTGGGTCCCGGGAGCCCCTGCTCCGTGTGGCTGTGACTGGAGGCACCCACGGGAATG
AGATGTGTGGTGTCTACCTGGCCCGGTACTGGCTACAGAACCCAGGGGAGCTGCAGAGACCCAGCTTCTC
AGCCATGCCGGTTCTGGCCAACCCAGCAGCCACAGCTGCCTGTTGCCGTTACCTGGACCGTGATCTCAAC
CGCTCCTGCACCCTCACCTTCCTTGGCGGCAGAACCCGGGGATGCCCTGCCGCCTCTTTCTGTATGAGCC
AGCTGGGACGGAGACCTTCAGCGTGGAATCTATATCCAAGAATGGAATCTGTCTGGAGATGGGCCCACAG
CCTCAGGGCGTGCTGCGGGCCGACCTGTTCTCCCGGATGCGAGCTCTGGTGGCATCCATTCTGGACTTCA
TCGAGCTCTTCAACCAAGGCATGGACTTACCCGCCTTTGAGATGGATATCTACAGGAACTTGGGCAGTGT
GGACTTCCCACGCACTGCAGATGGTGACCTGGCTGGCACTGTGCACCCTCAACTGCAGGACCATGACTTT
GAGCCACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001302482
ORF Size 570 bp
Insert Size 570
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001302482.1, NP_001289411.1
RefSeq Size 994
RefSeq ORF 570
Locus ID 71670
Gene Summary This gene encodes a member of the aminoacylase family of enzymes. This enzyme specifically deacetylates N-acetyl aromatic amino acids and mercapturic acids. Action of this enzyme on metabolites of the environmental contaminant trichloroethylene leads to the generation of toxic products that may lead to kidney failure. This protein has been found to bind to the hepatitis C virus core protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Transcript Variant: This variant (4) differs in both UTRs and lacks an alternate exon in the 5' coding region compared to variant 1, resulting in a frameshift. The resulting protein (isoform 2) has a distinct C-terminus and is shorter than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.