Cdc42 (NM_001243769) Mouse Untagged Clone

CAT#: MC226182

Cdc42 (untagged) - Mouse cell division cycle 42 (Cdc42), transcript variant 2

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Cdc42
• Synonyms: AI747189; AU018915
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226182 representing NM_001243769
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCAGACAATTAAGTGTGTTGTTGTTGGTGATGGTGCTGTTGGTAAAACATGTCTCCTGATATCCTACA
  CAACAAACAAATTCCCATCGGAATATGTACCAACTGTTTTTGACAACTATGCAGTCACAGTTATGATTGG
  TGGAGAGCCATACACTCTTGGACTTTTTGATACTGCAGGGCAAGAGGATTATGACAGACTACGACCGCTA
  AGTTATCCACAGACAGATGTTTTTCTAGTATGTTTCTCAGTGGTCTCTCCATCCTCATTTGAAAATGTGA
  AAGAAAAGTGGGTGCCTGAGATAACTCACCACTGTCCAAAGACTCCTTTCTTGCTTGTTGGGACCCAAAT
  TGATCTCAGAGATGACCCCTCTACTATTGAGAAACTTGCCAAGAACAAACAGAAGCCTATTACTCCAGAG
  ACTGCTGAAAAGCTGGCGCGGGATCTGAAGGCTGTCAAGTATGTGGAGTGCTCTGCCCTCACACAGAGAG
  GTCTGAAGAATGTGTTTGATGAGGCTATCCTAGCTGCCCTCGAGCCTCCGGAAACTCAACCCAAAAGGAA
  GTGCTGTATATTCTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001243769
• ORF Size: 576 bp
• Insert Size: 576
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001243769.1, NP_001230698.1
• RefSeq Size: 1521
• RefSeq ORF: 576
• Locus ID: 12540
• Gene Summary: Plasma membrane-associated small GTPase which cycles between an active GTP-bound and an inactive GDP-bound state. In active state binds to a variety of effector proteins to regulate cellular responses. Involved in epithelial cell polarization processes. Regulates the bipolar attachment of spindle microtubules to kinetochores before chromosome congression in metaphase. Plays a role in the extension and maintenance of the formation of thin, actin-rich surface projections called filopodia. Mediates CDC42-dependent cell migration. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) uses an alternate 3' terminal exon, compared to variant 1. It encodes isoform 2, which is the same length but has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.