Lcn5 (NM_001276257) Mouse Untagged Clone

CAT#: MC226196

Lcn5 (untagged) - Mouse lipocalin 5 (Lcn5), transcript variant 3


  "NM_001276257" in other vectors (1)

Reconstitution Protocol

USD 210.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Lcn5"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Lcn5
Synonyms E-RABP; Erabp; MEP10
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226196 representing NM_001276257
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTGCTCAGTTGCTAGGCATATGGAGAGCATCATGCTCTTCACCTTGCTGGGACTGTGTGTGGGGCTGG
CAGCTGGCACAGAGGCTGCAGTGGTGAAGGACTTCGACGTAAACAAGTTTTTAGGCTTCTGGTATGAAAT
TGCCCTTGCCTCCAAGATGGGTGCATACGGCTTGGCACACAAGGAGGAGAAGATGGGAGCCATGGTGGTT
GAGCTGAAAGAGAACCTTCTGGCTCTGACCACCACCTATTACAATGAGGGCCACTGTGTGCTGGAGAAGG
TTGCAGCCACTCAGGTGGACGGTTCAGCGAAGTACAAGGTCACCAGAATATCAGGAGAGAAAGAAGTTGT
TGTTGTAGCCACAGACTACATGACGTATACTGTGATTGATATCACCTCTCTGGTGGCCGGGGCAGTACAT
CGAGCCATGAAACTGTACAGCCGGAGCTTGGACAACAATGGGGAAGCTCTGAATAATTTCCAGAAGATAG
CCTTGAAGCATGGGTTTTCAGAAACAGACATACACATTCTCAAGCATGACTATATAGAAATCAAGGCTTT
GCCAAAGCCAGGCAGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001276257
ORF Size 579 bp
Insert Size 579
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001276257.1, NP_001263186.1
RefSeq Size 804
RefSeq ORF 579
Locus ID 13863
Gene Summary This gene encodes a small secreted protein that is expressed in the epididymis and binds retinoic acid. The precursor protein is processed into both a longer major form and a shorter minor form. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013]
Transcript Variant: This variant (3) differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (c) is the same length but has a distinct C-terminus, compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.