Ms4a2 (NM_001276328) Mouse Untagged Clone

CAT#: MC226242

Ms4a2 (untagged) - Mouse membrane-spanning 4-domains, subfamily A, member 2 (Ms4a2), transcript variant 2


  "NM_001276328" in other vectors (1)

Reconstitution Protocol

USD 210.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Ms4a2"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Ms4a2
Synonyms Fce1b; Fcer1b; fcERI; FcRB; Fcrbeta; Ms4a1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226242 representing NM_001276328
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACACAGAAAATAGGAGCAGAGCAGATCTTGCTCTCCCAAATCCACAAGAATCCTCCAGTGCACCTG
ACATTGAACTCTTGGAAGCATCTCCTGCCAAAGCAGCCCCACCAAAGCAGACATGGCGGACATTTTTGAA
GAAAGAGTTGGAGTTCCTGGGAGCAACACAAATTCTGGTTGGTTTGATATGCCTTTGTTTTGGAACAATT
GTCTGCTCCGTACTCTATGTTTCAGACTTTGATGAAGAAGTGCTTTTACTTTATAAACTAGGCTATCCAT
TCTGGGGTGCAGTGCTGTTTGTTTTGTCTGGATTTTTGTCAATTATCTCCGAAAGAAAAAACACATTGTA
TCTGAATGTAACCGAAGACGACGGCTGCTTTGTGGCTTCTTTCACCACAGAACTGGTGTTGATGATGCTG
TTTCTCACCATCCTGGCCTTTTGCAGTGCTGTGTTGTTCACTATCTATAGGATTGGACAAGAGTTAGAAA
GTAAAAAGGTCCCAGATGATCGTCTTTATGAAGAATTAAATGTGTATTCACCAATTTACAGTGAGTTGGA
AGACAAAGGGGAAACATCTTCTCCAGTTGATTCATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001276328
ORF Size 597 bp
Insert Size 597
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001276328.1, NP_001263257.1
RefSeq Size 2648
RefSeq ORF 597
Locus ID 14126
Gene Summary This gene encodes a member of the membrane-spanning 4A family. The encoded protein is the beta subunit of the high affinity IgE receptor and is localized to the membrane. The encoded protein is required for full activation of mast cells, including the release of histamine. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Transcript Variant: This variant (2) uses an alternate in-frame splice site compared to variant 1. The encoded isoform (b) is shorter than isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.