Dgcr6 (NM_001289813) Mouse Untagged Clone

CAT#: MC226264

Dgcr6 (untagged) - Mouse DiGeorge syndrome critical region gene 6 (Dgcr6), transcript variant 1

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Dgcr6
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226264 representing NM_001289813
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGACCGCTATGCGGCCGCCGGGGATGAGGCGGCGGATCGGGCCCGGCAGCAGGAGCGGCACTACCAGC
  TGCTGTCAGCACTACAGAGCCTGGTCAAGGAGCTGCCCAGCTCCTTTCAGCAGCGCCTGTCCTACACCAC
  GCTCAGCGACTTGGCCCTGGCGCTGCTCGACGGAACGGTGTTTGAAATCGTGCAGGGTCTTCTGGAGATT
  CAGCACCTCACTGAGAAGAGCCTCTACAACCAGAGACTGCGGCTGCAGAACGAACACCGAGTGCTCAGAC
  AGACTCTAAGGCAGAAGCACCTGGAAGCCCAGCAGTCCTGCCGGCCCCACAACTTGCCAGTGCTCCAGGC
  AGCTCAGCAGCGTGAGCTGGAGTCATGGCAGGCCATGGAACATCGGATCCGGGAGGAGCAGCAGGCTATG
  GACCGAAAGATTGTCCTGGAGCTGGACCGGAAGGTTGCCGACCAGCAGAGCACACTGGAGAAGGCAGGGG
  TAGCTGGTTTCTACGTGACCACCAATCCTCAGGAGCTGACGCTGCAGATGAACCTATTGGAACTCATCAG
  GAAGCTGCAGCAGAGGGGCTGCCAAGTGGGAAAGGCAGCTCTGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001289813
• ORF Size: 606 bp
• Insert Size: 606
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001289813.1, NP_001276742.1
• RefSeq Size: 1364
• RefSeq ORF: 606
• Locus ID: 13353
• Gene Summary: This gene encodes a protein that is similar to the gonadal protein in Drosophila (fruit fly). The encoded protein is thought to play a role in migration of neural crest cells during development. Deletions in the human gene are associated with DiGeorge syndrome (or velocardiofacial syndrome) which has many clinical features including cardiac abnormalities, cleft palate, atypical facial features, hypocalcemia, hypoparathyroidism and defective development or congenital absence of the thymus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
  Transcript Variant: This variant (1) encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.