Kcnip2 (NM_001276358) Mouse Untagged Clone

CAT#: MC226405

Kcnip2 (untagged) - Mouse Kv channel-interacting protein 2 (Kcnip2), transcript variant d

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Kcnip2
• Synonyms: KChIP2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226405 representing NM_001276358
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGAACCGCTGCCCTCGCAGGTGCCGGAGCCCGTTGGGGCAGGCAGCTCGGTCTCTCTACCAGTTGGTGA
  CTGGGTCACTGTCGCCAGACAGCGTGGAGGATGAGTTTGAACTATCCACGGTGTGCCACCGGCCTGAGGG
  TCTGGAACAACTCCAGGAACAAACCAAGTTCACACGCAGAGAGTTGCAGGTCCTGTACAGAGGCTTCAAG
  AACGAATGTCCCAGCGGAATTGTCAACGAGGAGAACTTCAAGCAAATTTATTCTCAGTTCTTTCCCCAAG
  GAGACTCCAGCAACTACGCTACTTTTCTCTTCAATGCCTTTGACACCAACCATGATGGCTCTGTCAGTTT
  TGAGGACTTTGTGGCTGGTTTGTCAGTGATTCTTCGGGGAACCATAGATGATAGACTGAACTGGGCTTTC
  AACTTATATGACCTCAACAAGGATGGCTGTATCACGAAGGAGGAAATGCTCGACATCATGAAGTCCATCT
  ATGACATGATGGGCAAGTACACCTACCCTGCCCTCCGGGAGGAGGCCCCGAGGGAACACGTGGAGAGCTT
  CTTCCAGAAGATGGACAGAAACAAGGACGGCGTGGTGACCATTGAGGAATTCATTGAGTCTTGTCAACAG
  GACGAGAACATCATGAGGTCCATGCAACTCTTTGATAATGTCATCTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001276358
• ORF Size: 678 bp
• Insert Size: 678
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001276358.1, NP_001263287.1
• RefSeq Size: 2025
• RefSeq ORF: 678
• Locus ID: 80906
• Gene Summary: This gene encodes a member of the voltage-gated potassium channel-interacting protein (KCNIP) family. KCNIP family members are small calcium binding proteins that commonly exhibit unique variation at their N-termini, and which modulate A-type potassium channels. This gene is predominantly expressed in the adult heart, and to a lesser extent in the brain. Disruption of this gene is associated with susceptibility to cardiac arrhythmias and lack of transient outward potassium current in ventricular myocytes, and downregulated expression is associated with cardiac hypertrophy. The encoded protein has also been implicated as a repressor of immune response. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2013]
  Transcript Variant: This variant (d) uses an alternate 5' exon structure, lacks an in-frame segment in the coding region, and initiates translation at an alternate start codon, compared to variant a. The encoded isoform (d) has a distinct N-terminus and is shorter than isoform a.