Spred1 (NM_001277256) Mouse Untagged Clone

CAT#: MC226428

Spred1 (untagged) - Mouse sprouty protein with EVH-1 domain 1, related sequence (Spred1), transcript variant 2


  "NM_001277256" in other vectors (1)

Reconstitution Protocol

USD 240.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Spred1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Spred1
Synonyms 5730461F13Rik; AL024345; AW047647
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226428 representing NM_001277256
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGCGAGGAGACGGCGACTTCTGACAACGATAATAGTTATGCACGAGTGCGAGCTGTGGTGATGACCA
GAGATGACTCAAGTGGTGGATGGCTACCACTCGGAGGGAGCGGACTGAGCAGCGTCACTGTCTTCAGAGT
CCCTCATCAGGAAGAGAATGGCTGTGCGGACTTTTTTATCCGTGGAGAGAGACTCAGAGACAAAATGGTG
GTTTTGGAATGTATGCTTAAGAAAGACCTCATCTATAATAAGGTCACTCCCACATTTCACCACTGGAAGA
TCGATGACAAGAAGTTTGGCCTTACCTTTCAGAGTCCTGCTGATGCCAGGGCTTTTGATCGAGGCATTCG
AAGAGCTATAGAGGATATATCTCTAGGGTGCCCAGCGTCAAAAACTGAGGCTGAAGGAGGAGATGATGAT
TTACAAACGACTGAAGAAGACACTTCCCGTTCCCTAGTGAAAGATCACTTTTTCCAGCAAGAGACAGTTG
TTACCAGTGAACCTTACAGAAGCTCAGACATAAGACCGTTACCCTTTGAAGATCTGAATGCCAGAAGAGT
CTACTTGCAAAGCCAAGTCAGCCAGGTGAGAAGACGAATACTGTTTCCATGCATAGCTTATATAGAAAAG
CTGGGTGTGCTACAGAACACCAAGGCCCTCCGCTCTTTTCCATGTTACGAAACGATATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001277256
ORF Size 690 bp
Insert Size 690
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001277256.1, NP_001264185.1
RefSeq Size 2007
RefSeq ORF 690
Locus ID 114715
Gene Summary This gene encodes a membrane-associated protein that is phosphorylated by tyrosine kinases in response to growth factors. The encoded protein acts as a negative regulator of the mitogen-activated protein (MAP) kinase signaling pathway. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
Transcript Variant: This variant (2) lacks two 3' coding exons and its transcription extends past a splice site that is used in variant 1, resulting in a distinct 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.