Bdnf (NM_001048139) Mouse Untagged Clone

CAT#: MC226565

Bdnf (untagged) - Mouse brain derived neurotrophic factor (Bdnf), transcript variant 2


  "NM_001048139" in other vectors (2)

Reconstitution Protocol

USD 270.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Bdnf"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Bdnf
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226565 representing NM_001048139
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACCATCCTTTTCCTTACTATGGTTATTTCATACTTCGGTTGCATGAAGGCGGCGCCCATGAAAGAAG
TAAACGTCCACGGACAAGGCAACTTGGCCTACCCAGGTGTGCGGACCCATGGGACTCTGGAGAGCGTGAA
TGGGCCCAGGGCAGGTTCGAGAGGTCTGACGACGACATCACTGGCTGACACTTTTGAGCACGTCATCGAA
GAGCTGCTGGATGAGGACCAGAAGGTTCGGCCCAACGAAGAAAACCATAAGGACGCGGACTTGTACACTT
CCCGGGTGATGCTCAGCAGTCAAGTGCCTTTGGAGCCTCCTCTACTCTTTCTGCTGGAGGAATACAAAAA
TTACCTGGATGCCGCAAACATGTCTATGAGGGTTCGGCGCCACTCCGACCCTGCCCGCCGTGGGGAGCTG
AGCGTGTGTGACAGTATTAGCGAGTGGGTCACAGCGGCAGATAAAAAGACTGCAGTGGACATGTCTGGCG
GGACGGTCACAGTCCTAGAGAAAGTCCCGGTATCCAAAGGCCAACTGAAGCAGTATTTCTACGAGACCAA
GTGTAATCCCATGGGTTACACCAAGGAAGGCTGCAGGGGCATAGACAAAAGGCACTGGAACTCGCAATGC
CGAACTACCCAATCGTATGTTCGGGCCCTTACTATGGATAGCAAAAAGAGAATTGGCTGGCGATTCATAA
GGATAGACACTTCCTGTGTATGTACACTGACCATTAAAAGGGGAAGATAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001048139
ORF Size 750 bp
Insert Size 750
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001048139.1, NP_001041604.1
RefSeq Size 4161
RefSeq ORF 750
Locus ID 12064
Gene Summary The protein encoded by this gene is a member of the nerve growth factor family. It is involved in the growth, differentiation and survival of specific types of developing neurons both in the central nervous system (CNS) and the peripheral nervous system. It is also involved in regulating synaptic plasticity in the CNS. Expression of a similar gene in human is reduced in both Alzheimer's and Huntington disease patients. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate mature protein. [provided by RefSeq, Oct 2015]
Transcript Variant: This variant (2) differs in the 5' UTR and coding region, and uses a downstream translation start compared to variant 1. The resulting protein (isoform 2) has a shorter N-terminus compared to isoform 1. Variants 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 and 12 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.