Asgr1 (NM_001291132) Mouse Untagged Clone

CAT#: MC226606

Asgr1 (untagged) - Mouse asialoglycoprotein receptor 1 (Asgr1), transcript variant 3


  "NM_001291132" in other vectors (1)

Reconstitution Protocol

USD 270.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Asgr1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Asgr1
Synonyms ASGPR1; Asgr; Asgr-1; HL-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226606 representing NM_001291132
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACAAAGGATTATCAAGATTTCCAGCACCTGGACAATGATAATGACCATCATCAACTCCGGAGAGGGC
CGCCTCCCACTCCACGGCTCTTGCAGCGACTCTGCTCTGGATCCCGCCTCCTCCTGCTCTCCTCGAGCCT
CAGCATTCTGTTGCTGGTGGTTGTCTGTGTGATCACATCCCAAAATTCCCAACTCCGGGAAGATCTGCTG
GCTCTAAGGCAGAATTTCAGCAACCTCACTGTGAGCACTGAGGACCAGGTCAAGGCCCTGAGCACCCAGG
GAAGTAGTGTGGGAAGAAAGATGAAGTTAGTGGAGTCGAAGCTGGAAAAACAGCAGAAGGATCTGACTGA
AGGCTCTGAAAGGACCTGCTGCCCCATCAACTGGGTGGAGTATGAAGGCAGCTGCTACTGGTTCTCCAGC
TCTGTGAGGCCTTGGACTGAAGCTGACAAGTACTGCCAGCTGGAAAATGCCCATCTGGTGGTGGTGACCT
CCAGGGATGAGCAGAACTTCCTCCAGCGCCACATGGGCCCCTTAAACACTTGGATTGGCCTAACTGACCA
GAACGGGCCCTGGAAATGGGTGGATGGAACAGACTACGAGACAGGCTTCCAGAATTGGAGACCAGAGCAG
CCAGATAACTGGTACGGACATGGGCTTGGAGGAGGCGAGGACTGTGCCCACTTCACGACGGATGGCCGCT
GGAATGACGACGTCTGCAGGAGGCCCTACCGCTGGGTCTGTGAGACAAAGTTGGATAAGGCTAATTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001291132
ORF Size 768 bp
Insert Size 768
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001291132.1, NP_001278061.1
RefSeq Size 1173
RefSeq ORF 768
Locus ID 11889
Gene Summary Mediates the endocytosis of plasma glycoproteins to which the terminal sialic acid residue on their complex carbohydrate moieties has been removed. The receptor recognizes terminal galactose and N-acetylgalactosamine units. After ligand binding to the receptor, the resulting complex is internalized and transported to a sorting organelle, where receptor and ligand are disassociated. The receptor then returns to the cell membrane surface. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) lacks an exon in the central coding region, compared to variant 1. The encoded isoform (b) is shorter, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.