Setmar (NM_001276356) Mouse Untagged Clone

CAT#: MC226721

Setmar (untagged) - Mouse SET domain without mariner transposase fusion (Setmar), transcript variant 2


  "NM_001276356" in other vectors (1)

Reconstitution Protocol

USD 290.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Setmar"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Setmar
Synonyms 5830404F24Rik; Etet2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226721 representing NM_001276356
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACAGGAGCATCTCTTTCATCCCTGTAGGACATCCCTGCACAGCTAAAGTGTATACTCCTGATCATG
TTGCTGGACCTGGAGCAGACATTGACCCCACACAAATAACCTTCCCTGGATGTGCTTGCATCGAAACTCC
ATGTGTCCCTGGCACTTGCTCTTGTCTTCGCCATGAGAATAACTACGATGACAATTTATGCCTTAGGGAT
GTGGGATCCGAAGGAAAGTACGCCAAGCCAGTTTTTGAATGCAATGTTCTGTGCCAGTGTGGCATGCGCT
GCAGAAATAGGGTGGTCCAGAATGGCCTACACTTCCTTCTCCAGGTGTTCCAGACAGAGAAAAAAGGCTG
GGGACTTCGGACTTTGGAATTTATACCCAAGGGAAGATTTGTCTGTGAGTATGCTGGGGAGGTGTTAGGA
TTCTCTGAAGTGCAAAGAAGAATTCACCTACAAACATCACATGACTCAAATTACATCATCGCTGTCAGAG
AACACATTTACAGTGGACAGATCATGGAAACATTTGTCGACCCTACCTACATAGGAAATATTGGGAGATT
CCTCAACCATTCTTGTGAACCAAATCTGTTGATGATTCCTGTCCGAATTGACTCAATGGTACCCAAGCTG
GCACTTTTCGCAGCCAAAGATATTTTGCCAGGAGAAGAACTCTCTTACGACTATTCAGGAAGATTCCTTA
ACCAAGTAAGTAGTAAAGACAAAGAAAAGATAGACTGTAGCCCACCACGAAAGCCTTGTTACTGTGGGGC
CCAGTCATGCACCACTTTCCTGCCCTATGACAGTTCACTATATATGGCCCCTTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001276356
ORF Size 825 bp
Insert Size 825
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001276356.1, NP_001263285.1
RefSeq Size 1770
RefSeq ORF 825
Locus ID 74729
Gene Summary This gene encodes a histone-lysine N-methyltransferase that may be involved in the methylation of histone H3. In anthropoid primates this gene is a fusion gene of a SET histone-lysine N-methyltransferase and a mariner (MAR) family transposase. In all other species this gene contains only the SET domain. [provided by RefSeq, Jan 2013]
Transcript Variant: This variant (2) uses an alternate internal exon, compared to variant 1. This difference results in a distinct 5' UTR and causes translation initiation at an alternate start codon, compared to variant 1. The encoded protein (isoform 2) is shorter and has a distinct N-terminus compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.