Casp3 (NM_001284409) Mouse Untagged Clone

CAT#: MC226736

Casp3 (untagged) - Mouse caspase 3 (Casp3), transcript variant 1


  "NM_001284409" in other vectors (1)

Reconstitution Protocol

USD 290.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Casp3"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Casp3
Synonyms A830040C14Rik; AC-3; CASP-3; Caspase-3; CC3; CPP-32; CPP32; Lice; mldy; SCA-1; Yama
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226736 representing NM_001284409
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGAACAACAAAACCTCAGTGGATTCAAAATCCATTAATAATTTTGAAGTAAAGACCATACATGGGA
GCAAGTCAGTGGACTCTGGGATCTATCTGGACAGTAGTTACAAAATGGATTATCCTGAAATGGGCATATG
CATAATAATTAATAATAAGAACTTCCATAAGAGCACTGGAATGTCATCTCGCTCTGGTACGGATGTGGAC
GCAGCCAACCTCAGAGAGACATTCATGGGCCTGAAATACCAAGTCAGGAATAAAAATGATCTTACTCGTG
AAGACATTTTGGAATTAATGGATAGTGTTTCTAAGGAAGATCATAGCAAAAGGAGCAGCTTTGTGTGTGT
GATTCTAAGCCATGGTGATGAAGGGGTCATTTATGGGACAAATGGGCCTGTTGAACTGAAAAAGTTGACT
AGCTTCTTCAGAGGCGACTACTGCCGGAGTCTGACTGGAAAGCCGAAACTCTTCATCATTCAGGCCTGCC
GGGGTACGGAGCTGGACTGTGGCATTGAGACAGACAGTGGGACTGATGAGGAGATGGCTTGCCAGAAGAT
ACCGGTGGAGGCTGACTTCCTGTATGCTTACTCTACAGCACCTGGTTACTATTCCTGGAGAAATTCAAAG
GACGGGTCGTGGTTCATCCAGTCCCTTTGCAGCATGCTGAAGCTGTACGCGCACAAGCTAGAATTTATGC
ACATTCTCACTCGCGTTAACAGGAAGGTGGCAACGGAATTCGAGTCCTTCTCCCTGGACTCCACTTTCCA
CGCAAAGAAACAGATCCCGTGTATTGTGTCCATGCTCACGAAAGAACTGTACTTTTATCACTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001284409
ORF Size 834 bp
Insert Size 834
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001284409.1, NP_001271338.1
RefSeq Size 2610
RefSeq ORF 834
Locus ID 12367
Gene Summary This gene encodes a protein that belongs to a highly conserved family of cysteinyl aspartate-specific proteases that function as essential regulators of programmed cell death through apoptosis. Members of this family contain an N-terminal pro-domain and require cleavage at specific aspartate residues to become mature. The protein encoded by this gene belongs to a subgroup of cysteinyl aspartate-specific proteases that are activated by initiator caspases and that perform the proteolytic cleavage of apoptotic target proteins. Mice defective for this gene exhibit a variety of phenotypes including reduced neuronal apoptosis resulting in hyperplasias, hearing loss, attenuated osteogenic differentiation of bone marrow stromal stem cells, and pre- and post-natal lethality. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.