Adora3 (BC100416) Mouse Tagged ORF Clone

CAT#: MG201495

  • TrueORF®

Adora3 (GFP-tagged) - Mouse adenosine A3 receptor (cDNA clone MGC:118217 IMAGE:30916707)


Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Adora3"

Specifications

Product Data
Type Mouse Tagged ORF Clone
Tag TurboGFP
Symbol Adora3
Synonyms A3AR, ARA3
Vector pCMV6-AC-GFP
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MG201495 representing BC100416
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTTTGGCTGGAATAGAAAAGCAACCTTAGCGAGCTCTCAAAATAGCAGCACTCTTTTGTGCCACTTCC
GTTCCGTGGTCAGTTTGGATTACATGGTCTTCTTCAGCTTCGTCACCTGGATCCTCGTCCCCCTGGTTGT
CATGTGTGTCATCTACCTAGACATCTTCTACATCATCCGAAATAAGCTCAGTCAAAACCTGTCTGGCTTC
AGAGAGACGCGTGCATTTTATGGACGGGAGTTCAAGACAGCTAAGTCCCTGTTTCTGGTTCTCTTCTTGT
TTGCGCTGTGCTGGCTGCCTTTGTCCATCATCAATTTTGTTTCCTATTTTGATGTAAAGATACCAGATGT
CGCAATGTGCCTGGGGATCCTGTTGTCCCACGCGAACTCCATGATGAACCCTATTGTCTACGCCTGCAAA
ATAAAAAAGTTCAAAGAGACCTACTTTCTGATCCTCAGAGCTCTCAGGCTCTGTCAGACCTCAGATTCTT
TGGACTCAAACATGGAACAGACTACTGAG


AGCGGACCGACGCGTACGCGGCCGCTCGAG - GFP Tag - GTTTAA
Restriction Sites SgfI-RsrII      Cloning Scheme for this gene      Plasmid Map     
ACCN BC100416
ORF Size 519 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene.
Reference Data
RefSeq BC100416, AAI00417
RefSeq Size 1251
RefSeq ORF 521
Locus ID 11542
Gene Summary This gene encodes a protein that belongs to the family of adenosine receptors, which are G-protein-coupled receptors that are involved in a variety of intracellular signaling pathways and physiological functions. The receptor encoded by this gene mediates a sustained cardioprotective function during cardiac ischemia, it is involved in the inhibition of neutrophil degranulation in neutrophil-mediated tissue injury, it has been implicated in both neuroprotective and neurodegenerative effects, and it may also mediate both cell proliferation and cell death. This gene shares its 3' terminal exon with a transcript variant from overlapping GeneID:69296, which encodes an immunoglobulin domain-containing protein. [provided by RefSeq, Nov 2014]

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.