Cox6b2 (NM_183406) Mouse Tagged ORF Clone

CAT#: MR200215

Cox6b2 (Myc-DDK-tagged) - Mouse cytochrome c oxidase subunit VIb polypeptide 2 (Cox6b2), transcript variant 2

Specifications

Product Data

• Type: Mouse Tagged ORF Clone
• Tag: Myc-DDK
• Symbol: Cox6b2
• Synonyms: 1700067P11Rik; BC048670; COXVIB2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  ORF Nucleotide Sequence

  >MR200215 representing NM_183406
  Red=Cloning site Blue=ORF Green=Tags(s)
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTTGGGTGTTCAAGCCCAGAAGCCCCCTCCGGGCCAATGGACAACGCCGCCCTTTGATCCGCGCTTCC
  CTAACCAGAACCAGACGCGTAACTGCTACCAGAATTTTCTGGACTACCACCGGTGTGTGAAGACCATGAA
  TCGCCGCGGAAAGAGCACACAACCCTGCGAGTACTATTTCCGTGTATTCCATTCACTGTGTCCCATCAGC
  TGGGTGCAGCGCTGGAATGAGCAGATCAAGCAGGGAACTTTCCCGGGCAAAATA
  
  AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC
  TGGATTACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-RsrII Cloning Scheme for this gene Plasmid Map
• ACCN: NM_183406
• ORF Size: 264 bp
• OTI Disclaimer: The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene.

Reference Data

• RefSeq: NM_183406.1, NM_183406.2, NM_183406.3, NP_899665.1
• RefSeq Size: 491
• RefSeq ORF: 267
• Locus ID: 333182
• MW: 11 kDa