Msrb1 (NM_013759) Mouse Tagged ORF Clone

CAT#: MR227394

Msrb1 (Myc-DDK-tagged) - Mouse selenoprotein X 1 (Sepx1), (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below)

Specifications

Product Data

• Type: Mouse Tagged ORF Clone
• Symbol: Msrb1
• Synonyms: D17Wsu82e; SelR; SELX; Sepr; Sepx1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  ORF Nucleotide Sequence

  >MR227394 representing NM_013759
  Red=Cloning site Blue=ORF Green=Tags(s)
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTCGTTCTGCAGCTTCTTCGGAGGCGAGGTTTTCCAGAATCACTTCGAGCCAGGTGTCTACGTGTGTG
  CCAAGTGCAGCTATGAGCTGTTCTCCAGTCACTCGAAGTACGCACACTCATCCCCGTGGCCAGCGTTCAC
  TGAAACCATCCACCCAGACAGTGTGACCAAGTGCCCTGAGAAAAACCGACCAGAAGCTTTAAAGGTGTCC
  TGTGGCAAGTGTGGCAATGGGTTGGGCCACGAGTTCCTGAATGATGGCCCCAAGCGGGGACAATCAAGAT
  TCTGAATATTTAGCAGCTCACTGAAGTTCGTCCCTAAAGGCAAAGAAGCTGCTGCCTCCCAGGGGCAC
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI Cloning Scheme for this gene Plasmid Map
• ACCN: NM_013759
• OTI Disclaimer: The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info The expression of this clone is not guaranteed due to the nature of selenoproteins.
• OTI Annotation: This clone encodes a selenoprotein containing the rare amino acid selenocysteine (Sec). Sec is encoded by UGA codon, which normally signals translational termination. Expression of this clone is not guaranteed due to the nature of selenoproteins.

Reference Data

• RefSeq: NM_013759.1, NM_013759.2, NM_013759.3, NP_038787.1
• RefSeq Size: 904
• RefSeq ORF: 351
• Locus ID: 27361
• Gene Summary: The protein encoded by this gene belongs to the methionine-R-sulfoxide reductase B (MsrB) family. Members of this family function as repair enzymes that protect proteins from oxidative stress by catalyzing the reduction of methionine-R-sulfoxides to methionines. This protein is highly expressed in liver and kidney, and is localized to the nucleus and cytosol. It is the only member of the MsrB family that is a selenoprotein, containing a selenocysteine (Sec) residue at its active site. It also has the highest methionine-R-sulfoxide reductase activity compared to other members containing cysteine in place of Sec. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Oct 2016]