Il7 (NM_008371) Mouse Tagged ORF Clone

CAT#: MR227640

  • TrueORF®

Il7 (Myc-DDK-tagged) - Mouse interleukin 7 (Il7)


  "NM_008371" in other vectors (4)


Interest in protein/lysate? Submit request here!

Reconstitution Protocol

USD 200.00

In Stock*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Mouse Tagged ORF Clone
Tag Myc-DDK
Symbol Il7
Synonyms A630026I06Rik; hlb368; Il-7
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MR227640 representing NM_008371
Red=Cloning site Blue=ORF Green=Tags(s)

CTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTTCCATGTTTCTTTTAGATATATCTTTGGAATTCCTCCACTGATCCTTGTTCTGCTGCCTGTCACAT
CATCTGAGTGCCACATTAAAGACAAAGAAGGTAAAGCATATGAGAGTGTACTGATGATCAGCATCGATGA
ATTGGACAAAATGACAGGAACTGATAGTAATTGCCCGAATAATGAACCAAACTTTTTTAGAAAACATGTA
TGTGATGATACAAAGGAAGCTGCTTTTCTAAATCGTGCTGCTCGCAAGTTGAAGCAATTTCTTAAAATGA
ATATCAGTGAAGAATTCAATGTCCACTTACTAACAGTATCACAAGGCACACAAACACTGGTGAACTGCAC
AAGTAAGGAAGAAAAAAACGTAAAGGAACAGAAAAAGAATGATGCATGTTTCCTAAAGAGACTACTGAGA
GAAATAAAAACTTGTTGGAATAAAATTTTGAAGGGCAGTATA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-MluI      Cloning Scheme for this gene      Plasmid Map     
ACCN NM_008371
ORF Size 462 bp
OTI Disclaimer The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene.
Reference Data
RefSeq NM_008371.1, NM_008371.2, NM_008371.3, NM_008371.4, NM_008371.5, NP_032397.1
RefSeq Size 2475
RefSeq ORF 465
Locus ID 16196
MW 18.2 kDa
Gene Summary The protein encoded by this gene is a hematopoietic growth factor important for B and T cell development. Alternative splicing results in several transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.