Spag11b (NM_001037850) Rat Untagged Clone
CAT#: RN200015
Spag11c (untagged ORF) - Rat sperm-associated antigen 11 variant C (Spag11c), transcript variant 2, (10 ug)
"NM_001037850" in other vectors (3)
Product Images
Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Symbol | Spag11b |
Synonyms | Spag11c |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN200015 representing NM_001037850
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAAACGGAGACTCCTTCCTTCCTTTGTCAGCCTCCTCCTTGCAGCCCTGCTCCTTCCAGGGTCGTCCA GTGCCTCGTCCATTAACCACTTAGTCACTGAACCCCCCAGTTCCCCCCAGGACGAATTTCCTGCCCAAGG AGGAAATGGGTCTGGGTTGTTGCATCACAGAGTGAAACGCTTCCCTCCACGCACCCCCCCTTACCATGAG CCTGGACCAAATTACCAAATTGTCAACTGCAAGAAAAATGAGGGATTCTGTCAAAAATACTGTAATTTTA TGGAAACACAAGTGGGCTACTGTTCAAAAAAGAAAGAAGCCTGCTGCTTACATCCCTTCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001037850 |
Insert Size | 342 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001037850.1, NP_001032939.1 |
RefSeq Size | 342 bp |
RefSeq ORF | 342 bp |
Locus ID | 652998 |
Cytogenetics | 16q12.5 |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR200015 | Spag11c (Myc-DDK-tagged ORF) - Rat sperm-associated antigen 11 variant C (Spag11c), transcript variant 2, (10 ug) |
USD 420.00 |
|
RR200015L3 | Lenti ORF clone of Spag11c (Myc-DDK-tagged ORF) - Rat sperm-associated antigen 11 variant C (Spag11c), transcript variant 2, (10 ug) |
USD 640.00 |
|
RR200015L4 | Lenti ORF clone of Spag11c (mGFP-tagged ORF) - Rat sperm-associated antigen 11 variant C (Spag11c), transcript variant 2, (10 ug) |
USD 700.00 |
{0} Product Review(s)
Be the first one to submit a review