Ensa (NM_021842) Rat Untagged Clone

CAT#: RN200330

Ensa (untagged ORF) - Rat endosulfine alpha (Ensa), transcript variant 2, (10 ug)

Specifications

Product Data

• Type: Rat Untagged Clone
• Tag: Tag Free
• Symbol: Ensa
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >RN200330 representing NM_021842
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTCCCAGAAACAAGAAGAAGAAAACCCTGCGGAGGAAACCGGCGAGGAGAAGCAGGATACACAGGAGA
  AAGAAGGTATTCTTCCTGAGAAAGCTGAGGAAGCAAAGCTAAAGGCCAAATATCCAAGCCTAGGACAAAA
  GCCTGGAGGCTCCGACTTCCTCATGAAGAGACTCCAGAAAGGGCAAAAGTACTTTGACTCAGGAGACTAC
  AACATGGCCAAAGCCAAGATGAAGAACAAGCAGCTACCGAGTGCAGGAGCAGACAAGAACCTGGTGACCG
  GTGACCACATCCCCACCCCACAGGACCTGCCCCAGAGAAAGTCCTCGCTCGTCACCAGCAAGCTTGCGGG
  TGGCCAAGTTGAATGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_021842
• ORF Size: 366 bp
• Insert Size: 366
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_021842.3, NP_068614.1
• RefSeq Size: 1186
• RefSeq ORF: 366
• Locus ID: 60334
• Gene Summary: may mediate insulin secretion through interaction with the pancreatic beta-cell ATP-sensitive potassium (K(ATP)) channel [RGD, Feb 2006]
  Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region and a different 3' terminal exon compared to variant 1. The resulting protein (isoform 2) is longer and has a distinct C-terminus compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.