Cox6a2 (NM_012812) Rat Untagged Clone

CAT#: RN200438

Cox6a2 (untagged ORF) - Rat cytochrome c oxidase, subunit VIa, polypeptide 2 (Cox6a2), nuclear gene encoding mitochondrial protein, transcript variant 1, (10 ug)


  "NM_012812" in other vectors (3)

Reconstitution Protocol

USD 420.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "Cox6a2"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Cox6a2
Synonyms COX6AH
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN200438 representing NM_012812
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTCTGCCTCTTAAGGTCCTCAGTCGGAGCATGGCCAGCGCATCCAAAGGAGACCACGGAGGCGCAG
GAGCCAACACTTGGCGCCTCCTGACCTTTGTGCTGGCTCTCCCCAGCGTAGCTCTCTGCTCGCTTAACTG
CTGGATGCACGCTGGCCACCATGAGCGCCCAGAATTCATCCCCTATCACCACCTCCGCATCCGAACCAAG
CCCTTCTCCTGGGGGGATGGGAACCACACGCTTTTCCACAATCCCCACGTCAATCCTTTGCCCACCGGCT
ACGAGCAGCCTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_012812
ORF Size 294 bp
Insert Size 294
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_012812.3, NP_036944.2
RefSeq Size 493
RefSeq ORF 294
Locus ID 25278
Gene Summary heart isoform of subunit VIa of cytochrome c oxidase [RGD, Feb 2006]
Transcript Variant: This variant (1) encodes the longer transcript.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.