Prm3 (NM_001002855) Rat Untagged Clone

CAT#: RN202368

Prm3 (untagged ORF) - Rat protamine 3 (Prm3), (10 ug)

Specifications

Product Data

• Type: Rat Untagged Clone
• Tag: Tag Free
• Symbol: Prm3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >RN202368 representing NM_001002855
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGGTTCCCGCTGTGCCAAGCTCAGCACCGGCCACGGCCCGGCCCAGAACACGGGTCACAGCCGTGGCC
  ACGAGTCCTCCATGAAGAAACTCGTGGCCTGTGTGAGTCAAGACAACTTCTCCCTGTCATCAGAGGGTGA
  GGAAGAGGAGGAGGATGAGGAAGATGAGGAGGAGGAAGATGATGATGAGGAAGACGAGGAGGAGGAGCAG
  ATCCCGGTGAAAGGCAAGCTGCTGCTGCTGGAGCCCGAAAAGCAAGATGGTGCTGAGGATGCTGTGGCCC
  AGCCAAGCCCGGAGCCCAAGCAGAAGCACTCCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001002855
• Insert Size: 315 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001002855.2, NP_001002855.1
• RefSeq Size: 515 bp
• RefSeq ORF: 315 bp
• Locus ID: 442921
• Cytogenetics: 10q11
• Gene Summary: Protamines substitute for histones in the chromatin of sperm during the haploid phase of spermatogenesis. They compact sperm DNA into a highly condensed, stable and inactive complex. [UniProtKB/Swiss-Prot Function]