Ly6g6d (NM_001001970) Rat Untagged Clone
CAT#: RN202814
Ly6g6d (untagged ORF) - Rat lymphocyte antigen 6 complex, locus G6D (Ly6g6d), (10 ug)
"NM_001001970" in other vectors (3)
Product Images
Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Symbol | Ly6g6d |
Synonyms | G6d; Ly6-D; Ng25 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN202814 representing NM_001001970
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAACTCCCAGTTGATCGGGATCCTGTTCAGCGCCCTGCTAGGGGCTGCCCTGGGACAGCGCATGCGGT GCTATGACTGCGGTGGAGGCCCCAGCAACTCCTGCAAGCAGACAGTGATCACCTGTGGTGAAGGTGAGCG CTGTGGATTCCTGGACCGCAAACCTCAACCCAGCTCAGAACAAGCCAAGCAACCCTCTGCGACCTTGAGC CATCACTACCCAGCCTGCGTGGCCACGCATCATTGCAACCAAGTGGCCATAGAGTCAGTGGGAGACGTGA CTTTTACAACCCAGAAAAACTGCTGCTTCGGAGACCTGTGCAACGGCGCCGTGGCAAGCTCCTCGACCCC ATTGTGCATCTTGGCTGCAGTTACCACCCTGGCCTGGCTCTTGTCAGGACAGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001001970 |
Insert Size | 405 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001001970.1, NP_001001970.1 |
RefSeq Size | 405 bp |
RefSeq ORF | 405 bp |
Locus ID | 415062 |
Cytogenetics | 20p12 |
Gene Summary | putative member of the Ly-6 superfamily, a group of GPI-anchored cell surface proteins; mouse human and rat homologs all localized to the MHC class III region [RGD, Feb 2006] |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR202814 | Ly6g6d (Myc-DDK-tagged ORF) - Rat lymphocyte antigen 6 complex, locus G6D (Ly6g6d), (10 ug) |
USD 420.00 |
|
RR202814L3 | Lenti ORF clone of Ly6g6d (Myc-DDK-tagged ORF) - Rat lymphocyte antigen 6 complex, locus G6D (Ly6g6d), (10 ug) |
USD 640.00 |
|
RR202814L4 | Lenti ORF clone of Ly6g6d (mGFP-tagged ORF) - Rat lymphocyte antigen 6 complex, locus G6D (Ly6g6d), (10 ug) |
USD 700.00 |
{0} Product Review(s)
Be the first one to submit a review