Atp6v0e1 (NM_053578) Rat Untagged Clone

CAT#: RN204104

Atp6v0e1 (untagged ORF) - Rat ATPase, H+ transporting, lysosomal 9kDa, V0 subunit e1 (Atp6v0e1), (10 ug)


  "NM_053578" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Atp6v0e1"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Atp6v0e1
Synonyms Atp6k; Atp6v0e; dsr-1; Dsr-1A
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN204104 representing NM_053578
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCATACCACGGCCTCACTGTGCCTTTGATCGTGATGAGCGTGTTCTGGGGCTTCGTGGGCCTCCTCG
TGCCCTGGTTTATCCCCAAGGGTCCTAACCGGGGAGTTATCATCACCATGTTGGTGACCTGTTCCGTTTG
CTGCTATCTCTTTTGGCTGATTGCGATTCTGGCGCAGCTCAATCCTCTGTTTGGACCACAGTTGAAAAAT
GAAACCATCTGGTATCTGAAGTATCACTGGCCTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_053578
ORF Size 246 bp
Insert Size 246
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_053578.3, NP_446030.3
RefSeq Size 835
RefSeq ORF 246
Locus ID 94170

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.