Gsta3 (NM_001009920) Rat Untagged Clone

CAT#: RN206410

Gsta5 (untagged ORF) - Rat glutathione S-transferase Yc2 subunit (Yc2), (10 ug)

Specifications

Product Data

• Type: Rat Untagged Clone
• Tag: Tag Free
• Symbol: Gsta3
• Synonyms: Gsta5; Yc2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >RN206410 representing NM_001009920
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCCGGGGAAGCCAGTCCTTCACTACTTCGATGGCAGGGGGAGAATGGAGCCCATCCGGTGGCTCCTGG
  CTGCAGCTGGAGTAGAGTTTGAAGAAAATTTTCTGAAAACTCGGGATGACCTGGCCAGGTTAAGAAGTGA
  TGGGAGTTTGATGTTTGAACAAGTGCCCATGGTGGAGATTGACGGGATGAAGCTGGTGCAGACCAAAGCC
  ATTCTCAACTACATTGCCACCAAATACAACCTCTATGGGAAGGACATGAAGGAGAGAGCCCTCATCGACA
  TGTATGCAGAAGGTGTGGCCGATCTGGAGTTGATGGTTCTCTATTACCCCTACATGCCCCCTGGGGAGAA
  AGAGGCGAGTCTTGCCAAGATCAAGGACAAAGCAAGGAACCGTTACTTCCCTGCCTATGAGAAGGTGTTG
  AAGAGCCACGGACAAGATTATCTCGTTGGCAACAAGCTGAGCAGGGCTGATGTTTCCCTGGTTGAACTTC
  TCTACCATGTGGAAGAGATGGACCCAGGCATTGTGGACAACTTCCCTCTGCTAAAGGCCCTGAGAACCAG
  AGTCAGCAACCTCCCCACAGTGAAGAAATTTCTTCAGCCTGGCAGCCAGAGGAAGCCTTTTGATGATGAG
  AAATGTGTAGAATCAGCGAAGAAGATCTTCAGTTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001009920
• Insert Size: 666 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001009920.2, NP_001009920.1
• RefSeq Size: 1508 bp
• RefSeq ORF: 666 bp
• Locus ID: 494500
• Cytogenetics: 9q13
• Gene Summary: Conjugation of reduced glutathione to a wide number of exogenous and endogenous hydrophobic electrophiles. Has substantial activity toward aflatoxin B1-8,9-epoxide. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (1) represents the longest transcript. Variants 1 and 2 encode the same protein (isoform 1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the Celera genome assembly. The genomic coordinates used for the transcript record were based on alignments.