Taf13 (NM_001107716) Rat Untagged Clone

CAT#: RN208130

Taf13 (untagged ORF) - Rat TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor (Taf13), (10 ug)


  "NM_001107716" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Taf13"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Taf13
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN208130 representing NM_001107716
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATGTATGGGTTTGGGGATGACCAGAATCCTTATACGGAGTCAGTGGATATTCTCGAAGACCTTGTCA
TAGAGTTCATCACTGAAATGACTCATAAGGCAATGTCAATTGGAAGACAAGGTCGAGTGCAAGTTGAAGA
TATTGTCTTCCTAATTCGAAAGGATCCGAGGAAGTTCGCTAGAGTTAAAGACTTACTAACTATGAATGAA
GAGTTGAAACGGGCTAGAAAAGCTTTCGACGAAGCCAACTATGGATCTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001107716
ORF Size 261 bp
Insert Size 261
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001107716.1, NP_001101186.1
RefSeq Size 1727
RefSeq ORF 261
Locus ID 310784

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.