Gtf2a2 (NM_053345) Rat Untagged Clone

CAT#: RN209035

Gtf2a2 (untagged ORF) - Rat general transcription factor IIA, 2 (Gtf2a2), (10 ug)


  "NM_053345" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Gtf2a2"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Gtf2a2
Synonyms MGC188808
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN209035 representing NM_053345
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCATATCAGTTATACAGAAATACAACTTTGGGGAACAGTCTTCAAGAGAGCCTTGATGAGCTCATAC
AGTCTCAACAGATCACCCCCCAGCTTGCCCTTCAAGTTCTACTTCAGTTTGATAAAGCTATAAATTCAGC
ATTGGCTCAGAGAGTCAGGAACAGAGTCAATTTCAGGGGCTCTCTAAATACATACAGATTCTGCGATAAT
GTTTGGACTTTTGTATTGAATGATGTTGAATTCAGAGAGGTGACAGAACTTATTAAAGTGGATAAAGTGA
AAATTGTAGCCTGTGATGGTAAAAATACCGGTTCCAATACCACGGAATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_053345
ORF Size 330 bp
Insert Size 330
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_053345.1, NP_445797.1
RefSeq Size 330
RefSeq ORF 330
Locus ID 83828
Gene Summary mouse homolog is a subunit of one of the general transcription factors that, with RNA polymerase II holoenzyme, forms the preinitiation complex to initiate transcription of class II genes [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.