Asip (NM_052979) Rat Untagged Clone

CAT#: RN209205

Asip (untagged ORF) - Rat agouti (A), (10 ug)


  "NM_052979" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Asip"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Asip
Synonyms ASP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN209205 representing NM_052979
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGATGTCACCCGCCTACTCCTGGCCACCCTCGTGGGCTTCCTGTGCTTCCTCACCGTCCACAGCCACC
TGGTATTTGAGGAGACGCTTGGAGATGACAGGAGTCTAAAGAGCAACTCTTCCATCAACTCACTGGATTT
CTCCTCTGTTTCCATTGTGGCACTGAACAAGAAATCCAAGAAGATCAGCAGAAAAGAAGCGGAGAAGCGG
AAGAGGTCTTCCAAGAAAAAGGCTTCGATAAAGAAGGTGGCACGGCCCCCGCCACCTTCGCCCTGCGTGG
CCACCCGCGACAGCTGCAAGCCGCCTGCGCCCGCCTGCTGCAACCCGTGCGCCTCCTGCCAGTGCCGTTT
CTTCGGCAGCGCCTGCACTTGCCGCGTACTCAACCCCAACTGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_052979
ORF Size 396 bp
Insert Size 396
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_052979.2, NP_443211.1
RefSeq Size 713
RefSeq ORF 396
Locus ID 24152
Gene Summary This gene is involved in hair pigmentation. In several strains (ACI, IS, LEA, LEC, NER, and WKAH) this gene encodes a functional protein while in others (BN, BUF, DON, F344, SD, SHR, TM, WKY, and WTC) it lacks a 19 nt indel and is non-protein coding. [provided by RefSeq, Apr 2015]
Transcript Variant: This variant (1, coding) represents the protein-coding allele.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.