Cycs (NM_012839) Rat Untagged Clone

CAT#: RN209474

Cycs (untagged ORF) - Rat cytochrome c, somatic (Cycs), nuclear gene encoding mitochondrial protein, (10 ug)


  "NM_012839" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Cycs"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Cycs
Synonyms CYCSA
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN209474 representing NM_012839
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAAAAGTGTGCCCAGTGCCACACTGTGGAAAAAG
GAGGCAAGCATAAGACTGGACCAAACCTCCATGGTCTGTTTGGGCGGAAGACAGGCCAGGCTGCTGGATT
CTCTTACACAGATGCCAACAAGAACAAAGGTATCACCTGGGGAGAGGATACCCTGATGGAGTATTTGGAA
AATCCCAAAAAGTACATCCCTGGAACAAAAATGATCTTCGCTGGAATTAAGAAGAAGGGAGAAAGGGCAG
ACCTAATAGCTTATCTTAAAAAGGCTACTAATGAATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_012839
ORF Size 318 bp
Insert Size 318
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_012839.2, NP_036971.1
RefSeq Size 1228
RefSeq ORF 318
Locus ID 25309
Gene Summary a component of the electron transport chain in mitochondria, may function in apoptosis [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.