Sec61g (NM_001135020) Rat Untagged Clone

CAT#: RN211386

Sec61g (untagged ORF) - Rat SEC61, gamma subunit (Sec61g), (10 ug)


  "NM_001135020" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Sec61g"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Sec61g
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN211386 representing NM_001135020
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGATCAGGTAATGCAGTTTGTCGAGCCAAGTCGGCAGTTTGTAAAGGACTCGATTCGGCTGGTTAAAA
GATGCACCAAACCTGATAGAAAAGAATTCCAGAAGATCGCCATGGCCACAGCGATTGGATTCGCTATCAT
GGGGTTCATCGGCTTCTTTGTGAAACTGATCCACATCCCTATTAATAACATTATTGTGGGTGGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001135020
ORF Size 207 bp
Insert Size 207
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001135020.1, NP_001128492.1
RefSeq Size 443
RefSeq ORF 207
Locus ID 689134

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.