Atp5l (NM_212516) Rat Untagged Clone

CAT#: RN212282

Atp5l (untagged ORF) - Rat ATP synthase, H+ transporting, mitochondrial F0 complex, subunit G (Atp5l), nuclear gene encoding mitochondrial protein, (10 ug)

Specifications

Product Data

• Type: Rat Untagged Clone
• Tag: Tag Free
• Symbol: Atp5l
• Synonyms: Atp5l
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >RN212282 representing NM_212516
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCCAAGTTCATCCGTAACCTCGCGGACAAGGCACCGTCGATGGTGGCGGCTGCCGTGACTTACTCGA
  AGCCTCGATTGGCCACATTTTGGCACTATGCTAGGGTTGAGCTGGTTCCCCCAACCCTTGGTGAAATCCC
  TACAGCTATTCAGAGCATGAAAAATATAATTCACAGTGCCCAAACTGGTAACTTCAAACACCTCACAGTT
  AAGGAAGCTGTGCTGAATGGTTTGGTGGCCACTGAGGTGTGGATGTGGTTTTATATCGGAGAGATCATAG
  GCAAACGTGGCATTGTTGGCTATGATGTTTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_212516
• ORF Size: 312 bp
• Insert Size: 312
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_212516.2, NP_997681.1
• RefSeq Size: 515
• RefSeq ORF: 312
• Locus ID: 300677
• Gene Summary: Mitochondrial membrane ATP synthase (F(1)F(0) ATP synthase or Complex V) produces ATP from ADP in the presence of a proton gradient across the membrane which is generated by electron transport complexes of the respiratory chain. F-type ATPases consist of two structural domains, F(1) - containing the extramembraneous catalytic core, and F(0) - containing the membrane proton channel, linked together by a central stalk and a peripheral stalk. During catalysis, ATP synthesis in the catalytic domain of F(1) is coupled via a rotary mechanism of the central stalk subunits to proton translocation. Part of the complex F(0) domain. Minor subunit located with subunit a in the membrane. [UniProtKB/Swiss-Prot Function]