Cstb (NM_012838) Rat Untagged Clone

CAT#: RN212694

Cstb (untagged ORF) - Rat cystatin B (stefin B) (Cstb), (10 ug)


  "NM_012838" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Cstb"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Cstb
Synonyms Cyb; Epm1; Stfb
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN212694 representing NM_012838
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATGTGTGGCGCGCCATCCGCCACAATGCCGGCCACGACCGAGACGCAGGAGATCGCCGACAAGGTGA
AGTCTCAACTTGAAGAGAAAGCAAATCAGAAGTTTGATGTCTTTAAAGCCATATCCTTCAGGAGACAGGT
AGTGGCCGGCACCAACTTCTTCATCAAGGTTGATGTCGGCGAAGAAAAATGTGTGCACTTGAGGGTGTTT
GAACCCCTCCCTCATGAGAACAAGCCTTTGACCTTGTCTTCTTACCAGACCGACAAAGAAAAGCACGATG
AGCTAACCTACTTCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_012838
ORF Size 297 bp
Insert Size 297
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_012838.2, NP_036970.1
RefSeq Size 610
RefSeq ORF 297
Locus ID 25308
Gene Summary inhibits the activity of cathepsins B, H, L, and S; may protect against apoptosis that occurs in response to seizures [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.