Dbil5 (NM_021596) Rat Untagged Clone

CAT#: RN213689

Dbil5 (untagged ORF) - Rat diazepam binding inhibitor-like 5 (Dbil5), (10 ug)


  "NM_021596" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Dbil5"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Dbil5
Synonyms Elp
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN213689 representing NM_021596
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGCCAAGTGGAGTTTGAAATGGCCTGCGCTTCACTCAAGCAGCTGAAGGGTCCTTTGAGTGATCAGG
AGAAACTGCTGGTGTACAGCTTCTACAAACAGGCCACCCAGGGCGACTGTAACATCCCTGTCCCTCCTGC
CACAGATGTGAAAGCAAAGGCCAAATGGGAGGCATGGATGGTAAACAAAGGGATGTCCAAGATGGATGCC
ATGAGGATCTACATTGCCAAAGTGGAAGAGCTGAAGAAAAACGAAACTTGCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_021596
ORF Size 264 bp
Insert Size 264
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_021596.2, NP_067607.1
RefSeq Size 562
RefSeq ORF 264
Locus ID 59116
Gene Summary may play roles in spermatogenesis and in fatty acid metabolism [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.