Rps28 (NM_001105730) Rat Untagged Clone

CAT#: RN214673

Rps28 (untagged ORF) - Rat ribosomal protein S28 (Rps28), (10 ug)


  "NM_001105730" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Rps28"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Rps28
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN214673 representing NM_001105730
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACACGAGTCGCGTGCAGCCCATCAAGCTGGCTAGGGTAACTAAAGTGCTGGGCAGGACCGGATCGC
AGGGACAGTGCACGCAGGTGCGAGTGGAATTTATGGATGACACCAGCCGCTCTATCATCCGAAACGTCAA
AGGCCCTGTTCGAGAGGGTGATGTGCTCACCCTGTTGGAGTCAGAAAGAGAAGCTCGGAGGTTGCGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001105730
ORF Size 210 bp
Insert Size 210
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001105730.1, NP_001099200.1
RefSeq Size 339
RefSeq ORF 210
Locus ID 691531
Gene Summary 40S ribosomal subunit protein [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.