Fxyd7 (NM_022008) Rat Untagged Clone
CAT#: RN215122
Fxyd7 (untagged ORF) - Rat FXYD domain-containing ion transport regulator 7 (Fxyd7), (10 ug)
"NM_022008" in other vectors (3)
Product Images
Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Symbol | Fxyd7 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN215122 representing NM_022008
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCACCCCAACCCAGAGCCCCACAAACGTTCCTGAAGAAACAGATCCTTTTTTCTATGACTATGCCA CCGTGCAGACTGTGGGGATGACCCTGGCCACTATCATGTTCGTGCTGGGCATCATCATCATCATCAGCAA GAAGGTTAAGTGCAGGAAGGCGGACTCCAGGTCTGAGAGCCCAACATGCAAATCCTGTAAGTCGGAACTG CCCTCCTCAGCCCCTGGAGGTGGCGGTGTGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_022008 |
ORF Size | 243 bp |
Insert Size | 243 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_022008.1, NP_071291.1 |
RefSeq Size | 714 |
RefSeq ORF | 243 |
Locus ID | 63848 |
Gene Summary | This reference sequence was derived from multiple ESTs and validated by similar mouse cDNA and human genomic sequence. This gene encodes a member of a family of small membrane proteins that share a 35-amino acid signature sequence domain, beginning with the sequence PFXYD and containing 7 invariant and 6 highly conserved amino acids. The approved human gene nomenclature for the family is FXYD-domain containing ion transport regulator. Transmembrane topology has been established for two family members (FXYD1 and FXYD2), with the N-terminus extracellular and the C-terminus on the cytoplasmic side of the membrane. FXYD2, also known as the gamma subunit of the Na,K-ATPase, regulates the properties of that enzyme. FXYD1 (phospholemman), FXYD2 (gamma), FXYD3 (MAT-8), FXYD4 (CHIF), and FXYD5 (RIC) have been shown to induce channel activity in experimental expression systems. This gene product, FXYD7, is novel and has not been characterized as a protein. [RefSeq curation by Kathleen J. Sweadner, Ph.D., sweadner@helix.mgh.harvard.edu., Dec 2000] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR215122 | Fxyd7 (Myc-DDK-tagged ORF) - Rat FXYD domain-containing ion transport regulator 7 (Fxyd7), (10 ug) |
USD 420.00 |
|
RR215122L3 | Lenti ORF clone of Fxyd7 (Myc-DDK-tagged ORF) - Rat FXYD domain-containing ion transport regulator 7 (Fxyd7), (10 ug) |
USD 640.00 |
|
RR215122L4 | Lenti ORF clone of Fxyd7 (mGFP-tagged ORF) - Rat FXYD domain-containing ion transport regulator 7 (Fxyd7), (10 ug) |
USD 700.00 |
{0} Product Review(s)
Be the first one to submit a review