Acbd7 (NM_001126079) Rat Untagged Clone

CAT#: RN215662

Acbd7 (untagged ORF) - Rat acyl-Coenzyme A binding domain containing 7 (Acbd7), (10 ug)


  "NM_001126079" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Acbd7"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Acbd7
Synonyms RGD1564164
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN215662 representing NM_001126079
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCCTTGCAGGCTGATTTTGACCAGGCCGCACAAGATGTGAGGAAGCTGAAAAGCAGACCGGAAGATG
AAGAGCTCAAGGAACTCTACGGGCTCTACAAACAGTCTGTCATCGGAGACATCAACATTGGTGCATGTCC
AGCAATGCTGGACTTAAAGGGCAAGGCCAAATGGGAAGCTTGGAACCTCCAAAAAGGGTTGTCGAAGGAA
GACGCCATGGGTGCCTACATTTCTAAAGCCAGAGAGCTGATTGAGAAATACGGAATTTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001126079
ORF Size 270 bp
Insert Size 270
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001126079.1, NP_001119551.1
RefSeq Size 533
RefSeq ORF 270
Locus ID 361277

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.