Amelx (NM_001271076) Rat Untagged Clone

CAT#: RN215729

Amelx (untagged) - Rat amelogenin, X-linked (Amelx), transcript variant 4

Specifications

Product Data

• Type: Rat Untagged Clone
• Tag: Tag Free
• Symbol: Amelx
• Synonyms: Amel; LRAP
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >RN215729 representing NM_001271076
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGGGACCTGGATCTTGTTTGCCTGCCTCCTGGGAGCAGCTTTTGCTATGCCCCTACCACCTCATCCTG
  GGAGCCCTGGTTATATCAACTTAAGCTATGAGGTGCTTACCCCCTTGAAGTGGTACCAGAGCATGATAAG
  GCAGCCGGCATTTTCTCCTATGAAGTGGTACCAGGGCACGGCAAGGCATCCGCTTAACATGGAAACCACA
  ACAGAAAAATGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001271076
• ORF Size: 222 bp
• Insert Size: 222
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001271076.1, NP_001258005.1
• RefSeq Size: 370
• RefSeq ORF: 222
• Locus ID: 29160
• Gene Summary: may play a role in mineralization of tooth enamel matrix [RGD, Feb 2006]
  Transcript Variant: This variant (4) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (4) has the same N- and C-termini but is shorter compared to isoform 1.