Znrd1 (NM_001166300) Rat Untagged Clone

CAT#: RN215853

Znrd1 (untagged) - Rat zinc ribbon domain containing 1 (Znrd1), transcript variant 1


  "NM_001166300" in other vectors (1)

Reconstitution Protocol

USD 210.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Znrd1"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Znrd1
Synonyms HTEX-6; Tctex6
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN215853 representing NM_001166300
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGCTGGCCCGCCCCTGCTCCAACTTTCAATCAGACTTGGATTTCTGCCCAGATTGTGGCTCCGTCC
TGCCGCTGCCTGGAGTTCAGGATACTGTCATCTGCCCTCGTTGTGGCTTCTCCATCGATGTGCGAGATTT
TGGAGGGAAGGTTGTGAAGACCTCAGTAGTGTTCAACAAACTGGGGACTGTCATACCTATGTCTGTGGAT
GAGGGACCTGAATCCCAGGGACCAGTAGTTGACAGGCGCTGCTCCCGATGTGGTCACGAGGGAATGGCAT
ACTACACCAGACAGATGCGCTCAGCTGATGAAGGACAGACTGTCTTCTATACCTGTATCAACTGCAAGTT
TCAGGAAAAGGAAGATTCTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001166300
ORF Size 372 bp
Insert Size 372
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001166300.1, NP_001159772.1
RefSeq Size 659
RefSeq ORF 372
Locus ID 361784
Gene Summary human homolog inhibits gastric cell proliferation and may be involved in control of gastric cancer development [RGD, Feb 2006]
Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.