Hint3 (NM_001276433) Rat Untagged Clone

CAT#: RN215866

Hint3 (untagged) - Rat histidine triad nucleotide binding protein 3 (Hint3), transcript variant 2

Specifications

Product Data

• Type: Rat Untagged Clone
• Tag: Tag Free
• Symbol: Hint3
• Synonyms: HINT-3; HINT-4; Hint4
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >RN215866 representing NM_001276433
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCTGAAAAGCAAGCGGGCTTAGCTGGAGAGCCGAATCCCGACTGTACGGTCACTGCCAAAGCAGGAC
  CTGAGGTGTCCTCGCCTGGGACCTCGGAGTCCAGGGACTATGACAGTAACTGCGTGTTCTGCCGCGTCGC
  GGCGGGTCAGGAACCCGAAACTGAACTCTTATACTGTGAGAACAAAGACCTGGTTTGTTTCAAAGATATC
  AAACCAGCAGCACTTCACCATTACCTCGTGGTGCCAAAAAAGCATATTGGAAGTTGCAAGGATCTAAACA
  AAGATCACATAGAAATGGTTGAGAGCATGGTCACTGTTGGAAAAACCATTCTTGAGAGGAATAATTTCAC
  AGACTTCACAGATGTGAGGTTGATTATTTGCTTGAAAAGCTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001276433
• ORF Size: 393 bp
• Insert Size: 393
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001276433.1, NP_001263362.1
• RefSeq Size: 833
• RefSeq ORF: 393
• Locus ID: 246769
• Gene Summary: member of the histidine triad protein family [RGD, Feb 2006]
  Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 3' coding region, which results in a frameshift, compared to variant 1. It encodes isoform 2 which has a shorter and distinct C-terminus compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.