Hint3 (NM_001276433) Rat Untagged Clone

CAT#: RN215866

Hint3 (untagged) - Rat histidine triad nucleotide binding protein 3 (Hint3), transcript variant 2


  "NM_001276433" in other vectors (1)

Reconstitution Protocol

USD 210.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Hint3"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Hint3
Synonyms HINT-3; HINT-4; Hint4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN215866 representing NM_001276433
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTGAAAAGCAAGCGGGCTTAGCTGGAGAGCCGAATCCCGACTGTACGGTCACTGCCAAAGCAGGAC
CTGAGGTGTCCTCGCCTGGGACCTCGGAGTCCAGGGACTATGACAGTAACTGCGTGTTCTGCCGCGTCGC
GGCGGGTCAGGAACCCGAAACTGAACTCTTATACTGTGAGAACAAAGACCTGGTTTGTTTCAAAGATATC
AAACCAGCAGCACTTCACCATTACCTCGTGGTGCCAAAAAAGCATATTGGAAGTTGCAAGGATCTAAACA
AAGATCACATAGAAATGGTTGAGAGCATGGTCACTGTTGGAAAAACCATTCTTGAGAGGAATAATTTCAC
AGACTTCACAGATGTGAGGTTGATTATTTGCTTGAAAAGCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001276433
ORF Size 393 bp
Insert Size 393
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001276433.1, NP_001263362.1
RefSeq Size 833
RefSeq ORF 393
Locus ID 246769
Gene Summary member of the histidine triad protein family [RGD, Feb 2006]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 3' coding region, which results in a frameshift, compared to variant 1. It encodes isoform 2 which has a shorter and distinct C-terminus compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.