Cd247 (NM_001205304) Rat Untagged Clone

CAT#: RN215883

Cd247 (untagged) - Rat Cd247 molecule (Cd247), transcript variant 2


  "NM_001205304" in other vectors (1)

Reconstitution Protocol

USD 210.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Cd247"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Cd247
Synonyms Cd3z; TCRzeta
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN215883 representing NM_001205304
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGTGGACGGCATCAGTCCTCGCCTGCATCCTTCAAGTGCAGTTCCCAGGAGCAGAGGCACAGAGCT
TTGGTCTGCTGGATCCCAAACTCTGCTATATGCTAGATGGAATCCTCTTCATCTACGGAGTCATCGTCAC
GGCCCTGTACCTGAGAGCAAAATTCAGCAGGAGTGCAGATGCTGCTGCTTACCTTCAGGACCCCAACCAG
CTCTATAACCAGAGGAGGAGGAACCCCCAGGAAGGCGTGTACAATGCACTGCAGAAAGACAAGATGGCAG
AGGCCTACAGTGAGATTGGCATGAAAGGCGAGAGGCGGAGAGGCAAGGGGCACGACGGCCTTTACCAGGG
TCTCAGCACTGCCACCAAGGACACCTATGACGCCCTGCATATGCAGACCCTGCCCCCTCGCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001205304
ORF Size 414 bp
Insert Size 414
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001205304.1, NP_001192233.1
RefSeq Size 1660
RefSeq ORF 414
Locus ID 25300
Gene Summary component of T cell receptor (TCR) complex that plays a role in TCR assembly and signaling; does not promote surface expression of Fc gamma RIII, unlike human homolog [RGD, Feb 2006]
Transcript Variant: This variant (2) lacks an in-frame coding exon, as compared to variant 1. The resulting isoform (2) lacks an internal segment, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.