Gsta3 (NM_001287025) Rat Untagged Clone

CAT#: RN215946

Gsta3 (untagged) - Rat glutathione S-transferase alpha 3 (Gsta3), transcript variant 3


  "NM_001287025" in other vectors (1)

Reconstitution Protocol

USD 210.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Gsta3"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Gsta3
Synonyms Gsta5; Yc2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN215946 representing NM_001287025
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTTTGAACAAGTGCCCATGGTGGAGATTGACGGGATGAAGCTGGTGCAGACCAAAGCCATTCTCAACT
ACATTGCCACCAAATACAACCTCTATGGGAAGGACATGAAGGAGAGAGCCCTCATCGACATGTATGCAGA
AGGTGTGGCCGATCTGGAGTTGATGGTTCTCTATTACCCCTACATGCCCCCTGGGGAGAAAGAGGCGAGT
CTTGCCAAGATCAAGGACAAAGCAAGGAACCGTTACTTCCCTGCCTATGAGAAGGTGTTGAAGAGCCACG
GACAAGATTATCTCGTTGGCAACAAGCTGAGCAGGGCTGATGTTTCCCTGGTTGAACTTCTCTACCATGT
GGAAGAGATGGACCCAGGCATTGTGGACAACTTCCCTCTGCTAAAGGCCCTGAGAACCAGAGTCAGCAAC
CTCCCCACAGTGAAGAAATTTCTTCAGCCTGGCAGCCAGAGGAAGCCTTTTGATGATGAGAAATGTGTAG
AATCAGCGAAGAAGATCTTCAGTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001287025
ORF Size 516 bp
Insert Size 516
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001287025.1, NP_001273954.1
RefSeq Size 1370
RefSeq ORF 516
Locus ID 494500
Gene Summary Conjugation of reduced glutathione to a wide number of exogenous and endogenous hydrophobic electrophiles. Has substantial activity toward aflatoxin B1-8,9-epoxide. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) lacks an alternate 5' exon compared to variant 1 that results in the use of a downstream translation initiation codon. The resulting protein (isoform 2) is shorter and has a distinct N-terminus compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the Celera genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.