Stmn4 (NM_001270858) Rat Untagged Clone

CAT#: RN215962

Stmn4 (untagged) - Rat stathmin-like 4 (Stmn4), transcript variant 5


  "NM_001270858" in other vectors (1)

Reconstitution Protocol

USD 210.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Stmn4"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Stmn4
Synonyms Lagl; Rb3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN215962 representing NM_001270858
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACCCTCGCAGCCTATAAGGAGAAGATGAAGGAACTCCCACTAGTGTCTCTGTTCTGCTCCTGTTTTC
TGTCTGATCCCCTGAATAAATCATCCTACAAATATGAAGCAGATACGGTAGACCTGAACTGGTGTGTCAT
CTCTGATATGGAAGTCATCGAGCTGAATAAGTGTACCTCGGGCCAGTCCTTTGAAGTCATCCTGAAGCCA
CCTTCCTTTGACGGGGTGCCTGAGTTTAATGCCTCCCTCCCAAGACGTCGAGACCCATCGCTAGAAGAGA
TACAGAAGAAGCTAGAAGCAGCAGAGGAGCGAAGGAAGTACCAGGAAGCTGAGCTCCTAAAACACCTTGC
AGAGAAACGAGAGCATGAGCGTGAGGTAATCCAGAAAGCTATCGAGGAAAACAACAACTTCATCAAGATG
GCGAAAGAGAAGCTGGCCCAGAAGATGGAGTCCAATAAGGAAAACCGGGAGGCCCATCTGGCTGCCATGT
TGGAGCGGCTGCAAGAGAAGGAGCCGCCTGCTGCGCGGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001270858
ORF Size 531 bp
Insert Size 531
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001270858.1, NP_001257787.1
RefSeq Size 1333
RefSeq ORF 531
Locus ID 79423
Gene Summary controls cell proliferation and activities for stathmin [RGD, Feb 2006]
Transcript Variant: This variant (5) lacks an alternate in-frame exon and has an alternate exon in the 3' end compared to variant 1. This additional exon has an in-frame stop codon, resulting in an isoform (e) with a shorter and distinct C-terminus and lacking an alternate internal segment compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.