Igf2 (NM_001190163) Rat Untagged Clone

CAT#: RN215971

Igf2 (untagged) - Rat insulin-like growth factor 2 (Igf2), transcript variant 3


  "NM_001190163" in other vectors (1)

Reconstitution Protocol

USD 210.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Igf2"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Igf2
Synonyms IGFII; RNIGF2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN215971 representing NM_001190163
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGGATCCCAGTGGGGAAGTCGATGTTGGTGCTTCTCATCTCTTTGGCCTTCGCCTTGTGCTGCATCG
CTGCTTACCGCCCCAGCGAGACTCTGTGCGGAGGGGAGCTTGTTGACACGCTTCAGTTTGTCTGTTCGGA
CCGCGGCTTCTACTTCAGCAGGCCTTCAAGCCGTGCCAACCGTCGCAGCCGTGGCATCGTGGAAGAGTGC
TGCTTCCGCAGCTGCGACTTGGCCCTCCTGGAGACATACTGTGCCACCCCCGCCAAGTCCGAGAGGGACG
TGTCTACCTCTCAGGCCGTACTTCCGGACGACTTCCCCAGATACCCCGTGGGCAAGTTCTTCAAATTCGA
CACCTGGAGACAGTCCGCGGGACGCCTGCGCAGAGGCCTGCCTGCCCTCCTGCGTGCCCGCCGGGGTCGC
ATGCTTGCCAAAGAGCTCGAAGCGTTCAGAGAGGCCAAGCGCCACCGTCCCCTGATCGTGTTACCACCCA
AAGACCCCGCCCACGGGGGAGCCTCTTCGGAGATGTCCAGCAACCATCAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001190163
ORF Size 543 bp
Insert Size 543
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001190163.1, NP_001177092.1
RefSeq Size 3507
RefSeq ORF 543
Locus ID 24483
Gene Summary a mitogenic growth factor; may have a role in fetal development [RGD, Feb 2006]
Transcript Variant: This variant (3) uses an alternate exon at its 5' terminus and uses a downstream in-frame start codon, compared to variant 1. This results in a protein (isoform 2) with a shorter N-terminus, compared to isoform 1. Variants 2 and 3 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.