Dbp (NM_001289983) Rat Untagged Clone

CAT#: RN215986

Dbp (untagged) - Rat D site of albumin promoter (albumin D-box) binding protein (Dbp), transcript variant 3

Specifications

Product Data

• Type: Rat Untagged Clone
• Tag: Tag Free
• Symbol: Dbp
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >RN215986 representing NM_001289983
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCGCGGCCTCTGAGCGACAGGACCCCGGGCCCCCTGCTGCTGGGTGGCCCGGCTGGGGCCCCCCCTG
  GCGGGGGAGCGCTGCTTGGGCTGAGGAGCCTTCTGCAGGGAAACAGCAAGCCCAAAGAACCGGCCAGCTG
  CTTGACCTCTAGGGACACACCCAGTCCTGTGGACCCAGACACCGTGGAGGTGCTAATGACCTTTGAACCT
  GATCCGGCTGATCTTGCCCTGTCAAGCATTCCAGGCCATGAGACTTTTGACCCTCGGAGGCACCGCTTCT
  CAGAGGAGGAATTGAAGCCTCAGCCAATCATGAAGAAGGCAAGGAAAGTCCAGGTGCCCGAGGAACAGAA
  GGATGAGAAGTACTGGAGCCGGAGGTACAAGAACAATGAAGCAGCCAAGAGGTCGAGAGACGCAAGAAGA
  CTCAAGGAGAACCAGATATCTGTGCGGGCAGCCTTCCTGGAGAAGGAAAACGCCCTATTGCGGCAGGAGG
  TGGTGGCTGTGCGGCAGGAGCTGTCCCACTACCGTGCTGTGCTTTCACGCTACCAGGCCCAACACGGGAC
  ACTGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001289983
• ORF Size: 567 bp
• Insert Size: 567
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001289983.1, NP_001276912.1
• RefSeq Size: 1249
• RefSeq ORF: 567
• Locus ID: 24309
• Gene Summary: The protein encoded by this gene is a member of the Par bZIP transcription factor family and binds to specific sequences in the promoters of several genes, such as albumin, Cyp2a4, and Cyp2a5. The encoded protein can bind DNA as a homo- or heterodimer and is involved in the regulation of some circadian rhythym genes. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2014]
  Transcript Variant: This variant (3) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (3) has the same N- and C-termini but is shorter compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.