Cryaa (NM_001289737) Rat Untagged Clone

CAT#: RN216010

Cryaa (untagged) - Rat crystallin, alpha A (Cryaa), transcript variant 2


  "NM_001289737" in other vectors (1)

Reconstitution Protocol

USD 210.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Cryaa"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Cryaa
Synonyms Acry-1; Crya1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN216010 representing NM_001289737
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACGTCACCATCCAGCACCCTTGGTTCAAGCGCGCCCTGGGGCCCTTCTACCCCAGCCGACTGTTCG
ACCAGTTCTTCGGCGAGGGCCTTTTTGAATACGACCTGCTGCCCTTCCTGTCTTCCACCATCAGCCCCTA
CTACCGCCAGTCTCTCTTCCGCACAGTGTTGGACTCCGGCATCTCTGAGCTCATGACCCATATGTGGTTT
GTAATGCACCAACCACATGCTGGAAACCCCAAGAACAACCCCGGCAAGGTCCGATCTGACCGGGACAAGT
TTGTCATCTTCTTGGATGTGAAGCACTTCTCTCCTGAGGACCTCACCGTGAAGGTACTGGAAGATTTCGT
GGAGATCCATGGCAAACACAACGAGAGGCAGGATGACCATGGCTACATTTCCCGTGAATTTCACCGTCGC
TACCGTCTGCCTTCCAATGTGGACCAGTCCGCCCTCTCCTGCTCCTTGTCTGCGGATGGCATGCTGACCT
TCTCTGGCCCCAAGGTCCAGTCTGGCTTGGATGCTGGCCACAGCGAGAGGGCCATTCCCGTGTCACGGGA
GGAGAAGCCCAGCTCGGCACCCTCGTCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001289737
ORF Size 591 bp
Insert Size 591
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001289737.1, NP_001276666.1
RefSeq Size 1120
RefSeq ORF 591
Locus ID 24273
Gene Summary This gene encodes subunit a, one of two subunits of alpha-crystallin, which is a high molecular weight, soluble aggregate and is a member of the small heat shock protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. It acts as a molecular chaperone and is the major protein in the eye lens, maintaining the transparency and refractive index of the lens. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Transcript Variant: This variant (2) includes an alternate in-frame exon in the central coding region, compared to variant 1. The encoded isoform (2, also known as alpha Ains-crystallin) is longer, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.