Dbp (NM_001289982) Rat Untagged Clone

CAT#: RN216088

Dbp (untagged) - Rat D site of albumin promoter (albumin D-box) binding protein (Dbp), transcript variant 2


  "NM_001289982" in other vectors (1)

Reconstitution Protocol

USD 230.00

3 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Dbp
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN216088 representing NM_001289982
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGCGGCCTCTGAGCGACAGGACCCCGGGCCCCCTGCTGCTGGGTGGCCCGGCTGGGGCCCCCCCTG
GCGGGGGAGCGCTGCTTGGGCTGAGGAGCCTTCTGCAGGGAAACAGCAAGCCCAAAGAACCGGCCAGCTG
TCTCCTGAAGGAAAAGGAGCGCAAGGCAACTCTGCCCTCAGCCCCCGTCCCGGGACCCGTCCTGGAAACG
GCGGGCCCAGCGGATGCCCCAACTGGGGCGGTTAGTGGCGGCTTGACCTCTAGGGACACACCCAGTCCTG
TGGACCCAGACACCGTGGAGGTGCTAATGACCTTTGAACCTGATCCGGCTGATCTTGCCCTGTCAAGCAT
TCCAGGCCATGAGACTTTTGACCCTCGGAGGCACCGCTTCTCAGAGGAGGAATTGAAGCCTCAGCCAATC
ATGAAGAAGGCAAGGAAAGTCCAGGTGCCCGAGGAACAGAAGGATGAGAAGTACTGGAGCCGGAGGTACA
AGAACAATGAAGCAGCCAAGAGGTCGAGAGACGCAAGAAGACTCAAGGAGAACCAGATATCTGTGCGGGC
AGCCTTCCTGGAGAAGGAAAACGCCCTATTGCGGCAGGAGGTGGTGGCTGTGCGGCAGGAGCTGTCCCAC
TACCGTGCTGTGCTTTCACGCTACCAGGCCCAACACGGGACACTGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001289982
ORF Size 678 bp
Insert Size 678
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001289982.1, NP_001276911.1
RefSeq Size 1360
RefSeq ORF 678
Locus ID 24309
Gene Summary The protein encoded by this gene is a member of the Par bZIP transcription factor family and binds to specific sequences in the promoters of several genes, such as albumin, Cyp2a4, and Cyp2a5. The encoded protein can bind DNA as a homo- or heterodimer and is involved in the regulation of some circadian rhythym genes. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2014]
Transcript Variant: This variant (2) uses an alternate in-frame splice junction at the 3' end of an exon compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.