POLR2J2 (NM_032958) Human Untagged Clone

CAT#: SC102102

POLR2J2 (untagged)-Human DNA directed RNA polymerase II polypeptide J-related gene (POLR2J2), transcript variant 2


Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "POLR2J2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol POLR2J2
Synonyms DNA directed RNA polymerase II polypeptide J-related; HRPB11B; MGC54043; MGC105050; polymerase (RNA) II (DNA directed) polypeptide J2; RPB11, HRPB11B, MGC54043, MGC105050; RPB11b1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_032958, the custom clone sequence may differ by one or more nucleotides


ATGAACGCCCCTCCAGCCTTCGAGTCGTTCTTGCTCTTCGAGGGCGAGAAGATCACCATTAACAAGGACA
CCAAGGTACCCAAGGCCTGCTTATTCACCATCAACAAAGAAGACCACACACTGGGAAACATCATTAAATC
ACGTGCCTGCTTCCCCTTCGCCTTCTGCCGTGATTGTCAGTTTCCTGAGGCCTCCCCAGCCACGCTTCCT
GTACAGCCTGCAGAACTCTGCCCCAGAGCACATCAGCTATGTGCCCCAGCTCTCAAACGACACCTTGGCG
GGGAGGCTCACCCTGTCCACCTTCACGCTGGAGCAGCCTCTAGGCCAGTTCAGCAGCCACAACATCTCTG
A


>OriGene 5' read for NM_032958 unedited
CGTCGCCATTTGTATACGACTCCTATAGGGCGGCCGCGAATTCGCACGAGGCTGGACGCA
ACGGCGGCGGGAGCATGAACGCCCCTCCAGCCTTCGAGTCGTTCTTGCTCTTCGAGGGCG
AGAAGATCACCATTAACAAGGACACCAAGGTACCCAATGCCTGCTTATTCACCATCAACA
AAGAAGACCACACACTGGGAAACATCATTAAATTACGTGCCTGCTTCCCCTTCGCCTTCT
GCCGTGATTGTCAGTTTCCTGAGGCCTCCCCAGCCACGCTTCCTGTACAGCCTGCAGAAC
TCTGCCCCAGAGCACATCAGCTATGTGCCCCAGCTCTCAAACGACACCTTGGCGGGGAGG
CTCACCCTGTCCACCTTCACGCTGGAGCAGCCTCTAGGCCAGTTCAGCAGCCACAACATC
TCTGACTTGGATACCATCTGGCTGGTGGTGGCCCTCAGCAACGCCACCCAGAGCTTCACG
GCCCCACGGACAAACCAGGACATCCCTGCTCCTGCCAACTTCTCCCAGAGGGGCTACTAT
CTCACACTGAGGGCCAACCGGGTGCTGTACCAGACCAGAGGCCAGCTCCATGTCCTCCGC
GTCGGCAATGATACCCACTGCCAACCAACAAAAATTGGCTGCAACCATCCCCTACCAGGA
CCCGGCCCCTACAGGGTGAAGTTCCTGGTGATGAATGACGAAGGACCCGTGGCTGAAACA
AATGGTCCAGCGACACTCGCCTGCAGCAAGCCCAGCACTTTGGGCTGTCCCCGGCCCCCA
NAGCCCGGCACCGTGGTCATAATGGCCCTCCTGTTTATNCTCCTGGCCGGCCTCCTCACG
GGACTCCTTGCCTGGGCTCATATACCCCTGCTTCAAAAGCTTGAGGAGCCCTTCCCTATC
AGGCCCCCAGAAGG
Restriction Sites NotI-NotI     
ACCN NM_032958
Insert Size 3830 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_032958.3, NP_116580.2
RefSeq Size 1552 bp
RefSeq ORF 351 bp
Locus ID 246721
Cytogenetics 7q22.1
Protein Families Transcription Factors
Protein Pathways Huntington's disease, Metabolic pathways, Purine metabolism, Pyrimidine metabolism, RNA polymerase
Gene Summary This gene is a member of the RNA polymerase II subunit 11 gene family, which includes three genes in a cluster on chromosome 7q22.1 and a pseudogene on chromosome 7p13. The founding member of this family, DNA directed RNA polymerase II polypeptide J, has been shown to encode a subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. This locus produces multiple, alternatively spliced transcripts that potentially express isoforms with distinct C-termini compared to DNA directed RNA polymerase II polypeptide J. Most or all variants are spliced to include additional non-coding exons at the 3' end which makes them candidates for nonsense-mediated decay (NMD). Consequently, it is not known if this locus expresses a protein or proteins in vivo. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2), also called beta, differs in the 3' coding region and UTR, compared to variant 1. Isoform 2 has a distinct C-terminus and is shorter than isoform 1.

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.