CD89 (FCAR) (D87858) Human Untagged Clone
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Other products for "FCAR"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | FCAR |
Synonyms | CD89|CTB-61M7.2|FcalphaRI |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for D87858 edited
ATGGACCCCAAACAGACCACCCTCCTGTGTCTTGTGCTCTGTCTGGGCCAGAGGATTCAG GCACAGGAAGGGAGGTATATTAGCGAGCATTTTTGGTGTAGAAGTTTGGGCTGCAATCCG GTAAATGATGCTTCAGCACAACGGCCAGGGGACTTTCCCATGCCTTTCATATCTGCCAAA TCGAGTCCTGTGATTCCCTTGGATGGATCTGTGAAAATCCAGTGCCAGGCCATTCGTGAA GCTTACCTGACCCAGCTGATGATCATAAAAAACTCCACGTACCGAGAGATAGGCAGAAGA CTGAAGTTTTGGAATGAGACTGATCCTGAGTTCGTCATTGACCACATGGACGCAAACAAG GCAGGGCGCTATCAGTGCCAATATAGGATAGGGCACTACAGATTCCGGTACAGTGACACC CTGGAGCTGGTAGTGACAGACTCCATCCACCAAGATTACACGACGCAGAACTTGATCCGC ATGGCCGTGGCAGGACTGGTCCTCGTGGCTCTCTTGGCCATACTGGTTGAAAATTGGCAC AGCCATACGGCACTGAACAAGGAAGCCTCGGCAGATGTGGCTGAACCGAGCTGGAGCCAA CAGATGTGTCAGCCAGGATTGACCTTTGCACGAACACCAAGTGTCTGCAAGTAA |
Restriction Sites | NotI-NotI |
ACCN | D87858 |
Insert Size | 2300 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | None |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | D87858.1, BAA13476.1 |
RefSeq Size | 654 bp |
RefSeq ORF | 654 bp |
Locus ID | 2204 |
Cytogenetics | 19q13.42 |
Protein Families | Transmembrane |
Gene Summary | 'This gene is a member of the immunoglobulin gene superfamily and encodes a receptor for the Fc region of IgA. The receptor is a transmembrane glycoprotein present on the surface of myeloid lineage cells such as neutrophils, monocytes, macrophages, and eosinophils, where it mediates immunologic responses to pathogens. It interacts with IgA-opsonized targets and triggers several immunologic defense processes, including phagocytosis, antibody-dependent cell-mediated cytotoxicity, and stimulation of the release of inflammatory mediators. Multiple alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]' |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.