GJA5 (NM_181703) Human Untagged Clone

CAT#: SC107351

GJA5 (untagged)-Human gap junction protein, alpha 5, 40kDa (GJA5), transcript variant B


  "NM_181703" in other vectors (4)

Reconstitution Protocol

USD 760.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "GJA5"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GJA5
Synonyms ATFB11; CX40
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_181703, the custom clone sequence may differ by one or more nucleotides


ATGGGCGATTGGAGCTTCCTGGGAAATTTCCTGGAGGAAGTACACAAGCACTCGACCGTGGTAGGCAAGG
TCTGGCTCACTGTCCTCTTCATATTCCGTATGCTCGTGCTGGGCACAGCTGCTGAGTCTTCCTGGGGGGA
TGAGCAGGCTGATTTCCGGTGTGATACGATTCAGCCTGGCTGCCAGAATGTCTGCTACGACCAGGCTTTC
CCCATCTCCCACATTCGCTACTGGGTGCTGCAGATCATCTTCGTCTCCACGCCCTCTCTGGTGTACATGG
GCCACGCCATGCACACTGTGCGCATGCAGGAGAAGCGCAAGCTACGGGAGGCCGAGAGGGCCAAAGAGGT
CCGGGGCTCTGGCTCTTACGAGTACCCGGTGGCAGAGAAGGCAGAACTGTCCTGCTGGGAGGAAGGGAAT
GGAAGGATTGCCCTCCAGGGCACTCTGCTCAACACCTATGTGTGCAGCATCCTGATCCGCACCACCATGG
AGGTGGGCTTCATTGTGGGCCAGTACTTCATCTACGGAATCTTCCTGACCACCCTGCATGTCTGCCGCAG
GAGTCCCTGTCCCCACCCGGTCAACTGTTACGTATCCCGGCCCACAGAGAAGAATGTCTTCATTGTCTTT
ATGCTGGCTGTGGCTGCACTGTCCCTCCTCCTTAGCCTGGCTGAACTCTACCACCTGGGCTGGAAGAAGA
TCAGACAGCGATTTGTCAAACCGCGGCAGCACATGGCTAAGTGCCAGCTTTCTGGCCCCTCTGTGGGCAT
AGTCCAGAGCTGCACACCACCCCCCGACTTTAATCAGTGCCTGGAGAATGGCCCTGGGGGAAAATTCTTC
AATCCCTTCAGCAATAATATGGCCTCCCAACAAAACACAGACAACCTGGTCACCGAGCAAGTACGAGGTC
AGGAGCAGACTCCTGGGGAAGGTTTCATCCAGGTTCGTTATGGCCAGAAGCCTGAGGTGCCCAATGGAGT
CTCACCAGGTCACCGCCTTCCCCATGGCTATCATAGTGACAAGCGACGTCTTAGTAAGGCCAGCAGCAAG
GCAAGGTCAGATGACCTATCAGTGTGA


Restriction Sites Please inquire     
ACCN NM_181703
Insert Size 2550 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation A TrueClone.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_181703.1, NP_859054.1
RefSeq Size 2566 bp
RefSeq ORF 1077 bp
Locus ID 2702
Cytogenetics 1q21.2
Protein Families Transmembrane
Gene Summary 'This gene is a member of the connexin gene family. The encoded protein is a component of gap junctions, which are composed of arrays of intercellular channels that provide a route for the diffusion of low molecular weight materials from cell to cell. Mutations in this gene may be associated with atrial fibrillation. Alternatively spliced transcript variants encoding the same isoform have been described. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (B) differs in the 5' UTR compared to variant A. Variants A and B encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.