GJA5 (NM_181703) Human Untagged Clone
CAT#: SC107351
GJA5 (untagged)-Human gap junction protein, alpha 5, 40kDa (GJA5), transcript variant B
"NM_181703" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | GJA5 |
Synonyms | ATFB11; CX40 |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_181703, the custom clone sequence may differ by one or more nucleotides
ATGGGCGATTGGAGCTTCCTGGGAAATTTCCTGGAGGAAGTACACAAGCACTCGACCGTGGTAGGCAAGG TCTGGCTCACTGTCCTCTTCATATTCCGTATGCTCGTGCTGGGCACAGCTGCTGAGTCTTCCTGGGGGGA TGAGCAGGCTGATTTCCGGTGTGATACGATTCAGCCTGGCTGCCAGAATGTCTGCTACGACCAGGCTTTC CCCATCTCCCACATTCGCTACTGGGTGCTGCAGATCATCTTCGTCTCCACGCCCTCTCTGGTGTACATGG GCCACGCCATGCACACTGTGCGCATGCAGGAGAAGCGCAAGCTACGGGAGGCCGAGAGGGCCAAAGAGGT CCGGGGCTCTGGCTCTTACGAGTACCCGGTGGCAGAGAAGGCAGAACTGTCCTGCTGGGAGGAAGGGAAT GGAAGGATTGCCCTCCAGGGCACTCTGCTCAACACCTATGTGTGCAGCATCCTGATCCGCACCACCATGG AGGTGGGCTTCATTGTGGGCCAGTACTTCATCTACGGAATCTTCCTGACCACCCTGCATGTCTGCCGCAG GAGTCCCTGTCCCCACCCGGTCAACTGTTACGTATCCCGGCCCACAGAGAAGAATGTCTTCATTGTCTTT ATGCTGGCTGTGGCTGCACTGTCCCTCCTCCTTAGCCTGGCTGAACTCTACCACCTGGGCTGGAAGAAGA TCAGACAGCGATTTGTCAAACCGCGGCAGCACATGGCTAAGTGCCAGCTTTCTGGCCCCTCTGTGGGCAT AGTCCAGAGCTGCACACCACCCCCCGACTTTAATCAGTGCCTGGAGAATGGCCCTGGGGGAAAATTCTTC AATCCCTTCAGCAATAATATGGCCTCCCAACAAAACACAGACAACCTGGTCACCGAGCAAGTACGAGGTC AGGAGCAGACTCCTGGGGAAGGTTTCATCCAGGTTCGTTATGGCCAGAAGCCTGAGGTGCCCAATGGAGT CTCACCAGGTCACCGCCTTCCCCATGGCTATCATAGTGACAAGCGACGTCTTAGTAAGGCCAGCAGCAAG GCAAGGTCAGATGACCTATCAGTGTGA |
Restriction Sites | Please inquire |
ACCN | NM_181703 |
Insert Size | 2550 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | A TrueClone. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_181703.1, NP_859054.1 |
RefSeq Size | 2566 bp |
RefSeq ORF | 1077 bp |
Locus ID | 2702 |
Cytogenetics | 1q21.2 |
Protein Families | Transmembrane |
Gene Summary | 'This gene is a member of the connexin gene family. The encoded protein is a component of gap junctions, which are composed of arrays of intercellular channels that provide a route for the diffusion of low molecular weight materials from cell to cell. Mutations in this gene may be associated with atrial fibrillation. Alternatively spliced transcript variants encoding the same isoform have been described. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (B) differs in the 5' UTR compared to variant A. Variants A and B encode the same protein. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221330 | GJA5 (Myc-DDK-tagged)-Human gap junction protein, alpha 5, 40kDa (GJA5), transcript variant B |
USD 420.00 |
|
RG221330 | GJA5 (GFP-tagged) - Human gap junction protein, alpha 5, 40kDa (GJA5), transcript variant B |
USD 460.00 |
|
RC221330L3 | Lenti ORF clone of Human gap junction protein, alpha 5, 40kDa (GJA5), transcript variant B, Myc-DDK-tagged |
USD 620.00 |
|
RC221330L4 | Lenti ORF clone of Human gap junction protein, alpha 5, 40kDa (GJA5), transcript variant B, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review