EDG8 (S1PR5) (NM_030760) Human Untagged Clone

CAT#: SC108034

S1PR5 (untagged)-Human sphingosine-1-phosphate receptor 5 (S1PR5), transcript variant 1


  "NM_030760" in other vectors (4)

Reconstitution Protocol

USD 310.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "S1PR5"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol S1PR5
Synonyms Edg-8; EDG8; S1P5; SPPR-1; SPPR-2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_030760, the custom clone sequence may differ by one or more nucleotides


ATGGAGTCGGGGCTGCTGCGGCCGGCGCCGGTGAGCGAGGTCATCGTCCTGCATTACAACTACACCGGCA
AGCTCCGCGGTGCGCGCTACCAGCCGGGTGCCGGCCTGCGCGCCGACGCCGTGGTGTGCCTGGCGGTGTG
CGCCTTCATCGTGCTAGAGAATCTAGCCGTGTTGTTGGTGCTCGGACGCCACCCGCGCTTCCACGCTCCC
ATGTTCCTGCTCCTGGGCAGCCTCACGTTGTCGGATCTGCTGGCAGGCGCCGCCTACGCCGCCAACATCC
TACTGTCGGGGCCGCTCACGCTGAAACTGTCCCCCGCGCTCTGGTTCGCACGGGAGGGAGGCGTCTTCGT
GGCACTCACTGCGTCCGTGCTGAGCCTCCTGGCCATCGCGCTGGAGCGCAGCCTCACCATGGCGCGCAGG
GGGCCCGCGCCCGTCTCCAGTCGGGGGCGCACGCTGGCGATGGCAGCCGCGGCCTGGGGCGTGTCGCTGC
TCCTCGGGCTCCTGCCAGCGCTGGGCTGGAATTGCCTGGGTCGCCTGGACGCTTGCTCCACTGTCTTGCC
GCTCTACGCCAAGGCCTACGTGCTCTTCTGCGTGCTCGCCTTCGTGGGCATCCTGGCCGCTATCTGTGCA
CTCTACGCGCGCATCTACTGCCAGGTACGCGCCAACGCGCGGCGCCTGCCGGCACGGCCCGGGACTGCGG
GGACCACCTCGACCCGGGCGCGTCGCAAGCCGCGCTCGCTGGCCTTGCTGCGCACGCTCAGCGTGGTGCT
CCTGGCCTTTGTGGCATGTTGGGGCCCCCTCTTCCTGCTGCTGTTGCTCGACGTGGCGTGCCCGGCGCGC
ACCTGTCCTGTACTCCTGCAGGCCGATCCCTTCCTGGGACTGGCCATGGCCAACTCACTTCTGAACCCCA
TCATCTACACGCTCACCAACCGCGACCTGCGCCACGCGCTCCTGCGCCTGGTCTGCTGCGGACGCCACTC
CTGCGGCAGAGACCCGAGTGGCTCCCAGCAGTCGGCGAGCGCGGCTGAGGCTTCCGGGGGCCTGCGCCGC
TGCCTGCCCCCGGGCCTTGATGGGAGCTTCAGCGGCTCGGAGCGCTCATCGCCCCAGCGCGACGGGCTGG
ACACCAGCGGCTCCACAGGCAGCCCCGGTGCACCCACAGCCGCCCGGACTCTGGTATCAGAACCGGCTGC
AGACTGA


Restriction Sites SgfI-MluI     
ACCN NM_030760
ORF Size 1197 bp
Insert Size 2191
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Reference Data
RefSeq NM_030760.4, NP_110387.1
RefSeq Size 2351
RefSeq ORF 1197
Locus ID 53637
Protein Families Druggable Genome, GPCR, Transmembrane
Protein Pathways Neuroactive ligand-receptor interaction
Gene Summary The lysosphingolipid sphingosine 1-phosphate (S1P) regulates cell proliferation, apoptosis, motility, and neurite retraction. Its actions may be both intracellular as a second messenger and extracellular as a receptor ligand. S1P and the structurally related lysolipid mediator lysophosphatidic acid (LPA) signal cells through a set of G protein-coupled receptors known as EDG receptors. Some EDG receptors (e.g., EDG1; MIM 601974) are S1P receptors; others (e.g., EDG2; MIM 602282) are LPA receptors. [supplied by OMIM, Mar 2008]
Transcript Variant: This variant (1) represents the shorter transcript. Both variants 1 and 2 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.