CEACAM1 (NM_001712) Human Untagged Clone
CAT#: SC108044
CEACAM1 (untagged)-Human carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein) (CEACAM1), transcript variant 1
"NM_001712" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CEACAM1 |
Synonyms | BGP; BGP1; BGPI |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001712, the custom clone sequence may differ by one or more nucleotides
ATGGGGCACCTCTCAGCCCCACTTCACAGAGTGCGTGTACCCTGGCAGGGGCTTCTGCTCACAGCCTCAC TTCTAACCTTCTGGAACCCGCCCACCACTGCCCAGCTCACTACTGAATCCATGCCATTCAATGTTGCAGA GGGGAAGGAGGTTCTTCTCCTTGTCCACAATCTGCCCCAGCAACTTTTTGGCTACAGCTGGTACAAAGGG GAAAGAGTGGATGGCAACCGTCAAATTGTAGGATATGCAATAGGAACTCAACAAGCTACCCCAGGGCCCG CAAACAGCGGTCGAGAGACAATATACCCCAATGCATCCCTGCTGATCCAGAACGTCACCCAGAATGACAC AGGATTCTACACCCTACAAGTCATAAAGTCAGATCTTGTGAATGAAGAAGCAACTGGACAGTTCCATGTA TACCCGGAGCTGCCCAAGCCCTCCATCTCCAGCAACAACTCCAACCCTGTGGAGGACAAGGATGCTGTGG CCTTCACCTGTGAACCTGAGACTCAGGACACAACCTACCTGTGGTGGATAAACAATCAGAGCCTCCCGGT CAGTCCCAGGCTGCAGCTGTCCAATGGCAACAGGACCCTCACTCTACTCAGTGTCACAAGGAATGACACA GGACCCTATGAGTGTGAAATACAGAACCCAGTGAGTGCGAACCGCAGTGACCCAGTCACCTTGAATGTCA CCTATGGCCCGGACACCCCCACCATTTCCCCTTCAGACACCTATTACCGTCCAGGGGCAAACCTCAGCCT CTCCTGCTATGCAGCCTCTAACCCACCTGCACAGTACTCCTGGCTTATCAATGGAACATTCCAGCAAAGC ACACAAGAGCTCTTTATCCCTAACATCACTGTGAATAATAGTGGATCCTATACCTGCCACGCCAATAACT CAGTCACTGGCTGCAACAGGACCACAGTCAAGACGATCATAGTCACTGAGCTAAGTCCAGTAGTAGCAAA GCCCCAAATCAAAGCCAGCAAGACCACAGTCACAGGAGATAAGGACTCTGTGAACCTGACCTGCTCCACA AATGACACTGGAATCTCCATCCGTTGGTTCTTCAAAAACCAGAGTCTCCCGTCCTCGGAGAGGATGAAGC TGTCCCAGGGCAACACCACCCTCAGCATAAACCCTGTCAAGAGGGAGGATGCTGGGACGTATTGGTGTGA GGTCTTCAACCCAATCAGTAAGAACCAAAGCGACCCCATCATGCTGAACGTAAACTATAATGCTCTACCA CAAGAAAATGGCCTCTCACCTGGGGCCATTGCTGGCATTGTGATTGGAGTAGTGGCCCTGGTTGCTCTGA TAGCAGTAGCCCTGGCATGTTTTCTGCATTTCGGGAAGACCGGCAGGGCAAGCGACCAGCGTGATCTCAC AGAGCACAAACCCTCAGTCTCCAACCACACTCAGGACCACTCCAATGACCCACCTAACAAGATGAATGAA GTTACTTATTCTACCCTGAACTTTGAAGCCCAGCAACCCACACAACCAACTTCAGCCTCCCCATCCCTAA CAGCCACAGAAATAATTTATTCAGAAGTAAAAAAGCAGTAA |
Chromatograms |
CHROMATOGRAMS
Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_001712 |
Insert Size | 3340 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001712.4, NP_001703.2 |
RefSeq Size | 3528 bp |
RefSeq ORF | 1581 bp |
Locus ID | 634 |
Cytogenetics | 19q13.2 |
Domains | ig, IGc2, IG |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | 'This gene encodes a member of the carcinoembryonic antigen (CEA) gene family, which belongs to the immunoglobulin superfamily. Two subgroups of the CEA family, the CEA cell adhesion molecules and the pregnancy-specific glycoproteins, are located within a 1.2 Mb cluster on the long arm of chromosome 19. Eleven pseudogenes of the CEA cell adhesion molecule subgroup are also found in the cluster. The encoded protein was originally described in bile ducts of liver as biliary glycoprotein. Subsequently, it was found to be a cell-cell adhesion molecule detected on leukocytes, epithelia, and endothelia. The encoded protein mediates cell adhesion via homophilic as well as heterophilic binding to other proteins of the subgroup. Multiple cellular activities have been attributed to the encoded protein, including roles in the differentiation and arrangement of tissue three-dimensional structure, angiogenesis, apoptosis, tumor suppression, metastasis, and the modulation of innate and adaptive immune responses. Multiple transcript variants encoding different isoforms have been reported, but the full-length nature of all variants has not been defined. [provided by RefSeq, May 2010]' Transcript Variant: This variant (1) represents the longest transcript and encodes the longest protein (isoform 1). This variant has been referred to by multiple names, including transmembrane carcinoembryonic antigen BGPa, TM1-CEA, and CEACAM1-4L. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221096 | CEACAM1 (Myc-DDK-tagged)-Human carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein) (CEACAM1), transcript variant 1 |
USD 480.00 |
|
RG221096 | CEACAM1 (GFP-tagged) - Human carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein) (CEACAM1), transcript variant 1 |
USD 530.00 |
|
RC221096L1 | Lenti-ORF clone of CEACAM1 (Myc-DDK-tagged)-Human carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein) (CEACAM1), transcript variant 1 |
USD 840.00 |
|
RC221096L2 | Lenti-ORF clone of CEACAM1 (mGFP-tagged)-Human carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein) (CEACAM1), transcript variant 1 |
USD 680.00 |
|
RC221096L3 | Lenti-ORF clone of CEACAM1 (Myc-DDK-tagged)-Human carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein) (CEACAM1), transcript variant 1 |
USD 680.00 |
|
RC221096L4 | Lenti-ORF clone of CEACAM1 (mGFP-tagged)-Human carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein) (CEACAM1), transcript variant 1 |
USD 680.00 |
{0} Product Review(s)
Be the first one to submit a review